RegulonDB RegulonDB 10.9: Gene Sequence
yedS gene sequence


Size: 1193        A: 321  T: 327  G: 306  C: 239

Fasta

 

>yedS E. coli K12. Version NC_000913.3 GI:556503834
atgaaaagaaaagttctggcaatgctggtcccggcgttattagttgctggcgcagcaaat
gcggctgaagtctataataaagatggtaataaactggatttgtacggaaaagtagtgggt
ctgcactacttctctgatgattctggcagcgatggcgacatgtcatatgcccgtatcggt
ttcaaaggtgaaactcagatcgctgatcaattcactggttatggtcagtgggaatttaac
attggcgcaaacggtcctgaaagcgacaagggtaataccgcaacgcgtctggcatttgca
ggtttaggctttggtcagaatggtactttcgactatggtcgtaactacggtgtcgtatat
gacgtagaagcatggaccgatatgctgccagaatttggtggcgatacctatgctggcgct
gacaacttcatgaacggtcgtgctaatggtgttgcaacctaccgtaacaatggcttcttt
ggttaggtcgatggcttgaactttgctttgcaatatcagggtaataatgaaagtggtgga
ccattcgggcaggaaggttccggtagtggtgatggccgtagcctttccaaagaaaatggt
gatggtttcggtatgtcaacatcctacgacttcgacttcggtttaagtctgggtgctgca
tatcaaactctgatcgttcagatcgtcaggttggagttggtttaaatgatcgtaaccata
gcaacagaaatgctggtggtgaaaccgctgaagcatggactgttggtgcaaaatatgatg
ctaataatgtgtatttagcagctatgtacgctgaaactcgcaatatgaccccatatggtg
gtggcgagtttgataatggtgaatcaagatcagccatcgctaacaaaacccaaaactttg
aagttgttgctcagtatcagttcgactttggcctgcgcccgtccatcgcttacctgcaat
ctaaaggtaaggatttaggcggttgggctcatgacggcaacggcgacccacgttacacca
ataaagatctggttaaatacgttgatattggtgcgacctactacttcaacaaaaacatgt
ccacctatgttgattacaaaatcaacctgctggacaacgacgatgacttctacgaagcaa
acggcatcgctaccgatgatatcgttgctgtgggcttagtctaccagttctaa
              
                            

Download fasta file
RegulonDB