RegulonDB RegulonDB 10.9: Gene Sequence
hchA gene sequence


Size: 852        A: 221  T: 217  G: 204  C: 210

Fasta

 

>hchA E. coli K12. Version NC_000913.3 GI:556503834
atgactgttcaaacaagtaaaaatccgcaggtcgatattgctgaagataatgcattcttc
ccttcagaatattcgcttagccaatataccagtcctgtctctgatcttgatggcgtggac
tatccaaaaccttatcgcggtaaacataaaattctggtgatcgccgcggacgaacgttat
ttgccgaccgataacggaaaactgttctcgaccggtaaccatccgattgaaacgttgctg
ccgttgtatcatctccatgctgcaggtttcgaattcgaagtggcgaccatttccggtctg
atgaccaagtttgaatactgggctatgccgcacaaagatgaaaaagtaatgccattcttt
gagcagcataaatcgttgttccgcaatccgaagaaactcgcggatgttgttgccagcctc
aacgctgatagcgaatatgcagcaatctttgttcctggtggtcatggcgcacttattggt
ttacctgaaagccaggacgtggctgccgctttacagtgggcaatcaaaaatgaccgtttt
gttatctccctttgccacggcccggcggcttttctggcgcttcgccacggcgataaccca
ctgaatggttattccatttgcgcattcccagacgccgcagacaaacaaacgccagagatt
ggctatatgccgggtcatctcacctggtacttcggcgaagaactgaagaaaatgggcatg
aatatcattaatgacgacatcaccgggcgagtacataaggaccgtaaacttctcaccggc
gacagtccttttgcagcgaatgcgttgggtaaactggcggcgcaggaaatgctggcagct
tacgcgggttaa
              
                            

Download fasta file
RegulonDB