RegulonDB RegulonDB 10.9: Gene Sequence
hprS gene sequence


Size: 1359        A: 425  T: 395  G: 293  C: 246

Fasta

 

>hprS E. coli K12. Version NC_000913.3 GI:556503834
atgaaaagactatctataaccgtccgtttaaccttgctttttatattgctactgtctgtt
gctggcgccggaattgtctggactctctataatggcctggcaagtgagttgaaatggcgc
gatgatacaacactcattaaccggacagcgcagatcaagcagttgttaattgatggggta
aatccagatacgttacctgtgtactttaaccggatgatggatgttagtcaggatatcttg
attattcatggtgatagcatcaataaaattgttaaccggacaaatgtcagtgatggcatg
ttaaataacatacctgctagtgagacaatcagcgcagctggcatttacagaagcattatt
aatgatacagagatagatgctttacgaattaatattgatgaagtttcgccatcattaacg
gttactgtggctaaattggcttcagccagacataacatgcttgaacagtataaaattaat
agcattataatttgcattgtcgccattgtactttgctcagtattaagtccgctgttaatc
agaacgggattacgagagatcaaaaagttgagtggtgtaacggaagcgctgaattataac
gatagccgagagcctgttgaggttagcgcattaccgagagaactaaaacctcttgggcag
gcgttgaataaaatgcatcatgctttagtcaaagattttgagcgtctaagtcagtttgct
gacgatctcgctcatgaacttagaacgccaattaatgcattactgggtcagaatcaggtt
acgctcagtcaaaccagaagtatcgctgaatatcaaaaaacaattgccggaaacattgaa
gagctggaaaatatttcgcggttaacagagaacatactgtttcttgccagggcagataaa
aacaatgttttggtgaaactggactcgctttctctcaataaggaagtcgaaaatttgttg
gactatcttgaatacctttcagacgagaaagagatttgctttaaggtcgagtgcaatcag
caaatctttgcggataaaattttactacaacgaatgttatcgaatcttattgttaatgcc
attagatattcgccagaaaaatcgcgtattcatataaccagttttcttgataccaacagc
tatcttaatattgatatcgccagccctggaacgaaaattaatgagcctgaaaaactcttc
cgtagattttggcggggagataattcgcgtcattccgtaggtcagggactaggcctttct
ttagtcaaagcgattgccgaattgcatgggggaagtgctacgtatcactatctcaataag
cataatgtgttccggattacgttaccgcaaagaaattaa
              
                            

Download fasta file
RegulonDB