RegulonDB RegulonDB 10.9: Gene Sequence
hprR gene sequence


Size: 672        A: 188  T: 183  G: 174  C: 127

Fasta

 

>hprR E. coli K12. Version NC_000913.3 GI:556503834
atgaagattctacttattgaagataatcaaaggacccaggaatgggtaacgcaggggctt
tccgaagcgggttatgtcatcgatgccgtttctgatggcagagatgggctttatcttgcg
ctgaaggatgattatgcattgatcattctggatattatgcttccgggtatggatggctgg
cagatcttacaaacgttaagaacagcaaagcaaacccctgttatttgccttactgcaagg
gattctgtcgatgacagagtcagagggctggacagtggggcaaatgattatctggtaaaa
cctttttcattttctgagttgctggcaagggttcgggcacaattaaggcaacatcacgct
ttgaattcaacattagaaatcagcggcttaagaatggactctgttagtcatagtgtgagc
agggacaatatcagtattacactgacgcgcaaggagtttcagttactttggctactggcc
tccagagctggcgaaattatacccagaacggttattgcgagtgaaatttggggaatcaac
tttgatagtgataccaatacggtggacgtcgccattcgcaggctccgcgcaaaagttgat
gatccttttcctgaaaagctaattgccacaatccgggggatgggctattcattcgtagcg
gtaaaaaaataa
              
                            

Download fasta file
RegulonDB