RegulonDB RegulonDB 10.9: Gene Sequence
hiuH gene sequence


Size: 414        A: 130  T: 111  G: 84  C: 89

Fasta

 

>yedX E. coli K12. Version NC_000913.3 GI:556503834
atgttaaagcgttatttagtactctcggtagcaacggcagcattttcattaccttctttg
gttaatgccgcacaacaaaacattcttagcgtgcacattttgaaccagcaaacaggaaaa
cccgctgctgacgtgacagtcactcttgaaaagaaggcggataacggctggttacaactt
aataccgccaaaacagataaggatggacgaattaaggcactgtggcccgagcaaactgca
actacgggcgattaccgtgtcgtatttaaaaccggggactatttcaagaaacaaaatctt
gaaagtttcttccctgagatccccgttgaatttcatattaataaagtgaacgagcattat
catgtgcctttattacttagccaatatgggtattcaacctatcgtggcagttaa
              
                            

Download fasta file
RegulonDB