RegulonDB RegulonDB 10.8: Gene Sequence
msrP gene sequence


Size: 1005        A: 244  T: 237  G: 267  C: 257

Fasta

 

>msrP E. coli K12. Version NC_000913.3 GI:556503834
atgaaaaagaatcaatttttaaaagaatcagatgttacggccgagtcggtattctttatg
aagcgtcggcaggtgttaaaagcactgggcatcagtgcaactgcactttctttgcctcac
gctgcgcatgccgatctgcttagctggtttaaagggaacgatcgcccgcccgcccccgcc
ggaaaagcgctggagttcagcaagcctgccgcctggcaaaataacctgccactgacgcca
gcagataaagtttccggttataataacttctatgaattcgggctggataaagccgatccc
gccgctaatgctggtagcctgaaaaccgatccatggacactgaaaatcagcggcgaagtg
gcaaaaccattgaccctcgatcatgatgacttaacccgtcgcttcccgctggaagagcgt
atttatcgtatgcgctgcgtggaagcgtggtcgatggtggtgccgtggattggttttccg
ctgcacaaattgctggcgcttgccgaacctaccagcaatgcgaagtatgtcgctttcgaa
acaatttatgcaccggaacagatgccaggccagcaggaccgctttatcggcggtgggctg
aaatatccttatgtcgaaggattgcgtctcgacgaagcaatgcatccgctcacactgatg
accgtaggtgtttatggcaaggcgttaccgccacaaaatggcgcgccggtgcgactgatt
gtgccgtggaaatatggctttaaagggattaaatcgatagtcagtattaagctgacccgc
gagcgtccgccaaccacctggaatctggcagcgcctgacgaatacggtttttacgccaac
gttaatccgtatgttgatcacccgcgctggtcacaggctaccgaacgatttattggttca
ggcggcatcctcgatgtacagcgccagccaacgctactgtttaatggttacgccgcccag
gtggcatcgctgtatcgtggcctggatttgcgggagaatttctaa
              
                            

Download fasta file
RegulonDB