RegulonDB RegulonDB 10.9: Gene Sequence
yeeJ gene sequence


Size: 7077        A: 2008  T: 1531  G: 1782  C: 1756

Fasta

 

>yeeJ E. coli K12. Version NC_000913.3 GI:556503834
atggctacgaagaagagaagtggagaagaaataaatgaccgacaaatattatgcgggatg
ggaattaaactacgccgcttaactgcgggtatctgtctgataactcaacttgcgttccct
atggctgcggcagcacaaggtgtggtaaacgccgcaacccaacaaccagttcctgcacaa
attgccattgcaaatgccaatacggtgccctacacccttggagcgttggaatcggcccaa
agcgttgccgaacgtttcggtatttcggtggctgagttacgcaaactcaaccagtttcgt
acgtttgctcgaggttttgataatgtccgccagggtgatgaactggatgtcccggcacaa
gttagtgaaaaaaaattaaccccgccgccgggtaatagcagtgacaacctcgagcaacag
atagccagtacttcacagcaaatcgggtctctgctcgccgaagatatgaacagcgagcaa
gcggcaaatatggcgcgtggatgggcctcttctcaggcttcaggcgcaatgacagactgg
ttaagccgcttcggtaccgcaagaatcacgctgggcgtggatgaagattttagcctgaag
aactcccagttcgattttctccatccgtggtatgaaacgcctgataatctctttttcagt
cagcatactctccatcgtactgacgagcgtacgcagattaacaacggcttaggttggcgt
catttcactcccacatggatgtcgggcatcaacttctttttcgaccacgatcttagccgt
taccactcccgcgccggcattggcgcggagtactggcgcgactatctaaaattaagcagt
aacggctatttgcgactgaccaactggcgcagcgcacctgaactggacaacgattatgaa
gcacgcccggccaatggctgggatgtacgcgcagaaagctggctacccgcctggccgcac
cttggcggtaaactggtctatgaacagtattatggcgatgaagtggccctgttcgataaa
gacgatcggcaaagtaatcctcatgccataaccgctggacttaactatacccccttcccg
ctgatgaccttcagcgcggagcaacgccagggtaaacagggcgaaaatgacacccgtttt
gccgtcgattttacctggcaacctggcagcgcaatgcagaaacagcttgacccgaatgaa
gtcgctgcacggcgtagccttgcaggcagccgttatgatctggtggatcgcaacaacaat
atcgttctggaatatcgcaaaaaagaactggttcgcctgaccctgacagaccccgtgaca
gggaagtcaggagaagtgaaatcactggtttcgtcgctacaaaccaaatatgccctgaaa
ggctataacgtcgaagccaccgcactggaagctgccggtggcaaagtggtcacaacgggt
aaagatattctggttaccctgccggcttaccggttcaccagtacgccagaaaccgataac
acctggccgattgaagtcaccgccgaagatgtcaaaggcaatttgtcgaatcgtgaacag
agcatggtggtcgttcaggcacctacgctaagccagaaagattcctcggtatcgttaagt
acccaaacattgaacgcggattcccattcaaccgccacactgacttttattgcgcatgat
gcagcaggtaatcctgttgtcgggctggtgctctcgacgcgtcacgaaggtgttcaggac
atcaccctttctgactggaaagataatggtgacggaagctatacccagatcctgaccaca
ggagcgatgtctggcacgctgacgctgatgccacagctgaatggtgtggatgcggctaaa
gcccccgccgtggtgaatatcatttctgtttcgtcatcccgaactcactcgtcaattaag
attgataaggaccgttatctctccggcaatcctatcgaggtgacggtagaactgagagat
gaaaatgacaaacctgttaaggaacaaaaacagcaactgaataacgcagtcagcatcgac
aacgtgaaaccaggagtcactacagactggaaagaaaccgcagatggcgtctataaggcg
acctataccgcctataccaaaggcagtggacttactgcgaagctattaatgcaaaactgg
aatgaagatttgcataccgctggatttatcatcgacgccaacccgcagtcagcgaaaatt
gcgacattatctgccagcaataatggtgtgctcgccaatgagaatgcagcaaacaccgtc
tcggtcaatgtcgctgatgaaggaagcaacccaatcaatgatcataccgtcacgtttgcg
gtattaagcggatcggcaacttccttcaacaatcaaaacaccgcaaaaacggatgttaat
ggtctggcgacttttgatctgaaaagtagtaagcaggaagacaacacggttgaagtcacc
cttgaaaatggcgtgaaacaaacgttaatcgtcagttttgtcggcgactcgagtactgcg
caggttgatctgcagaagtcgaaaaatgaagtggttgctgacggcaatgacagcgtcaca
atgaccgcgaccgtccgggatgcaaaaggcaacctgctcaatgacgtcatggtcactttc
aatgttaattcagcagaggcgaaactgagccaaaccgaagtgaatagccacgacgggatc
gccacagctacgctgaccagtttgaaaaatggtgattatagggttacggcctctgtgagc
tctggttcccaggctaatcaacaggtgaattttatcggtgatcaaagtactgctgccctg
accctcagtgtgccttcaggtgatatcaccgtcaccaacacagctccgcaatatatgact
gcaaccttgcaggataaaaatggcaacccactaaaagataaagaaatcaccttctctgtg
ccaaacgacgtcgcaagtaagttctcgattagcaacggaggaaaaggcatgacggatagt
aacggggttgcaatcgcctccctgaccggcacgttagcgggcacgcatatgatcatggct
cgtctggctaacagcaatgtcagcgatgcacagccaatgacgtttgtggcggataaagac
agagcggttgtcgttttgcaaacatcgaaagcggaaatcattgggaatggcgtggatgag
acaactctgacagcaacagtgaaagatccgtcgaatcatccggtggcggggataacggta
aacttcaccatgccacaggacgttgcggcaaactttacccttgaaaataacggtattgcc
atcactcaggccaatggggaagcgcatgtcacgctgaaaggtaaaaaagcgggcacgcat
acggttaccgcaacgctgggtaataacaataccagtgattcgcagccggtaacatttgtg
gcggacaaagcctcggctcaggttgtcctgcagatatcaaaagatgagatcacaggtaat
ggcgtcgatagcgcaacgctaactgcaacggttaaagatcagttcgacaatgaggtgaat
aatcttccggtaacattcagctcagcctcttcaggactcaccctgaccccgggagtaagt
aataccaacgagtctggcatcgcgcaggccactctcgcaggcgttgcctttggtgagaag
acggttactgcatcactggctaataatggtgccagcgacaacaaaactgtgcattttatt
ggcgacacagcggcggcaaaaattatcgagttggcgcctgtcccagacagcataatcgcc
ggtaccccgcagaacagctccggcagcgtcatcaccgccacagtcgttgataataatggc
tttccggtgaaaggtgtgactgtgaacttcaccagcaacgcagcgacagccgaaatgacg
aacggcggtcaagccgtgacgaacgaacagggtaaggctaccgtcacttataccaatacc
cgctcctcgatagaatcaggagcgagaccggataccgttgaggccagtctggaaaatggt
agctccacgcttagcacatcaattaatgtcaacgctgatgcgtctacggcacatctcacc
ttgctacaggcactttttgatacagtctccgcaggcgagacaaccagtctgtatattgag
gtgaaggataattacggcaacggtgtcccccagcaggaggtaaccctcagcgtttcacca
agtgaaggcgtgacccccagtaataacgctatatatactaccaaccacgacggcaatttt
tacgcaagctttaccgctacaaaagccggggtttatcaattgacggcaaccctcgaaaat
ggcgattcgatgcaacaaacagtgacctatgtgccgaacgtcgcgaatgctgaaatcacg
ctggcagcctcgaaggatccggtgattgccgacaataacgatctcacgacactaacagca
acagtcgctgatacagagggcaatgcgatagccaacactgaggtaacatttactctgccg
gaagatgtgaaggcgaacttcacgctgagcgatggcggtaaagtgattactgatgctgaa
ggcaaagcgaaagtcacgctgaaaggtacaaaagcaggcgctcatactgttacagcatcg
atgactggcggtaagagtgagcagttggtggtgaactttattgcggatacgctcactgcg
caggttaatcttaacgttaccgaggacaattttatcgctaataacgtcgggatgaccagg
ctgcaggcaacagtgactgatggaaacggcaacccgttagccaatgaggcggtgacattc
acgctaccggcagatgtgagcgcaagctttactctcggacaaggcggttccgccattact
gatatcaacggcaaggctgaagttacactgagcggtacaaaatccggcacctaccccgtg
acagttagcgtgaacaattatggtgtcagtgatacgaaacaggtgactttgattgccgat
gctggtaccgcaaaactagcctccttaacctctgtatactcattcgtcgtcagcacgacc
gagggcgcaaccatgacggcaagcgtcactgacgctaacggcaacccggtagaaggcata
aaagttaatttccgcggaacctccgtcacgctaagcagcaccagcgttgaaacggatgat
cggggtttcgctgaaattcttgtgacaagcaccgaggtcggactgaaaacagtttcagcc
tctctggcagataaacctactgaagtcatctcgcgattactgaatgccagtgcagatgtt
aattctgcgacgattaccagtctggagataccggaaggtcaggtaatggtcgcacaagac
gtagcagttaaagctcacgttaacgaccagtttggcaacccggttgcgcatcaacccgtg
acattcagtgcagagccatcctcgcaaatgatcatcagccagaatacggtctctactaat
acgcagggtgtagccgaggtcaccatgacgcccgaaagaaacggttcgtatatggtgaaa
gcatccctgccgaatggagcctcacttgagaaacaactggaggctattgatgaaaaactg
acactcacggcgtccagtccgcttatcggtgtctatgcccctacaggcgctactctgacg
gcaacgctaacctctgcaaatggcactccagtggagggtcaggtcatcaactttagcgta
acgccagaaggggcgacgttaagtggcggaaaagtgagaactaactcttcaggtcaggct
ccagtcgttttgaccagcaataaagtcggtacatatacggtgactgcatctttccataac
ggcgtaacaatacagacacagacaaccgtgaaagtcactggcaactcaagcaccgcccat
gttgctagctttatcgctgatccatcgactatcgccgccaccaacactgatttaagtacc
ttaaaggcaacggttgaggatggcagtggtaacctgatcgaaggtctcactgtgtacttc
gccttaaaaagcggctctgccacattaacgtcattaacagcggtgaccgatcaaaacgga
atcgcgacaacaagcgtgaaaggagcgatgacaggtagcgtcacggtaagcgcagtcacg
accgctggtggaatgcaaacagtagatataacgctggtggctggcccggcagacacctcg
cagtccgtccttaagagcaatcggtcatcactgaaaggggactataccgatagtgctgaa
ttacgtcttgttctgcacgatatatcaggcaatccgatcaaagtttctgaagggatggaa
tttgtgcaatcaggtactaacgtgccctatataaaaattagcgcaattgattacagtcta
aatatcaacggtgattacaaagccactgttacaggaggcggagagggtatcgcaacgctg
atccctgtattgaatggtgttcatcaagctggtctgagtaccacaatacaattcactcgc
gcagaagacaaaataatgagcggtacagtatcagtcaatggtactgacctaccgacaact
acattcccttcgcaggggttcaccggggcgtattatcagttgaataatgacaactttgcc
ccaggaaaaacggcggctgattatgagttttcaagctctgcctcctgggtcgatgttgat
gctaccggtaaagtgacatttaaaaatgtcggcagcaattcggaaaggattacggcgacg
ccaaaatcaggaggccctagctatgtatacgaaatccgtgtgaagagttggtgggtgaac
gccggcgaggctttcatgatatacagccttgctgaaaatttttgcagcagcaatggctac
acgctccccagagcaaactatttaaaccactgtagttcccgaggcatcgggtcactgtac
agtgaatggggagatatggggcattacacgactgacgctggttttcaatcaaatatgtat
tggtcatctagtcccgcaaactcaagcgaacaatacgtagtttccctggcaacaggtgat
caaagcgtatttgaaaagcttgggtttgcttatgcgacatgttataaaaacctgtga
              
                            

Download fasta file
RegulonDB