RegulonDB RegulonDB 10.9: Gene Sequence
yeeL gene sequence


Size: 1053        A: 341  T: 304  G: 216  C: 192

Fasta

 

>yeeL E. coli K12. Version NC_000913.3 GI:556503834
atgtttttagcatcattgttgagacgtattgcatttagttactacgattataaagcttat
aatttcaatattgaaaaaacagactttgttgtcatccatattcccgatcagattggcgat
gctatggccatctttcctgttattcgggcgcttgaattgcataaaattaagcatctttta
attgtaacgtcgacaattaatttagaagtctttaatgcgcttaaacttgaacagactaaa
ttaacattagtcacaatgactatgcaggatcacgcaacattaaaagaaataaaagattta
gcaaagaacataacacagcaatacggtacgccggatctttgcattgaggggatgcgtaaa
aagaacctgaaaacgatgttatttatcagtcagttgaaagcaaaaacgaattttcaggtt
gttggtataaccatgaattgcttctcccctttgtgcaagaacgcgtccagtatggatcag
aaactccgggctcccgtacctatgacatgggcatttatgatgcgtgaggcgggttttcca
gcagtcaggccaatatatgaattgccactaagtgaggatgtactcgatgaggtgcgcgag
gaaatgcgatcgttaggatcttacattgcgttcaatttagaaggtagctcgcaggaacgt
acattttcattatcgattgcagaaaatctaatagcaaaaatttaaagtgaaacagatata
ccaatagtgatcgttcatggacccaaaggtgaagataaagccagggcattagtggattgt
tataataatgtctaccgtttatccttaccaccctcgattaaacgttcagcagcaatcata
aaagatgcttatatcgcaataactcctgacacctcaatattacatatggcaagtgcctat
aatacccctgttgttgcaatttatgctgattacaaaacgcgatggcccgcaatggccgat
gtctcggagtcagtcgtcgttgggcaaaaaattgacaatataagtctggatgaattcgca
aaggcattaaaaagtgttttggcgagaatatga
              
                            

Download fasta file
RegulonDB