RegulonDB RegulonDB 10.9: Gene Sequence
shiA gene sequence


Size: 1317        A: 259  T: 394  G: 355  C: 309

Fasta

 

>shiA E. coli K12. Version NC_000913.3 GI:556503834
atggactccacgctcatctccactcgtcccgatgaagggacgctttcgttaagtcgcgcc
cgacgagctgcgttaggcagcttcgctggtgccgtcgtcgactggtatgattttttactc
tatggcatcaccgccgcactggtgtttaatcgcgagtttttcccgcaagtaagcccggcg
atgggaacgctcgccgcatttgctacctttggcgtcggatttcttttccgtccgctcggc
ggtgtcattttcggtcactttggcgaccgactgggacgtaagcgcatgttaatgctgacc
gtctggatgatgggcatcgcgacagccttgattggtattcttccttcattctcgaccatt
gggtggtgggcacctattttgctggtgacactgcgtgccattcagggatttgcagtcggc
ggcgaatggggaggcgcggcgttgctttccgttgaaagtgcaccgaaaaataaaaaagcc
ttttacagtagcggtgtacaagttggctacggtgtaggtttactgctttcaaccggactg
gtttcattgatcagtatgatgacgactgacgaacagtttttaagctggggctggcgcatt
cctttcctgtttagcatcgtactggtactgggagcattgtgggtgcgcaatggcatggag
gagtccgcggaatttgaacaacagcaacattatcaagctgccgcgaaaaaacgcatcccg
gttatcgaagcgctgttacgacatcccggtgctttcctgaagattattgcgctacgactg
tgcgaattgctgacgatgtacatcgttactgcctttgcacttaattattcaacccagaat
atggggctaccgcgcgaacttttccttaatattggtttgctggtaggtggattaagctgc
ctgacaattccctgttttgcctggcttgccgatcgttttggtcgccgtagggtttatatc
acaggtacgttaatcggaacgttgagcgcatttcctttctttatggcgcttgaagcacaa
tctattttctggatagttttcttctccataatgctggcaaacattgcgcatgacatggtg
gtgtgtgtgcaacaaccgatgtttaccgaaatgtttggtgccagttatcgctatagtggc
gctggagtcggttatcaggttgccagtgtggttggcggtggatttacaccttttattgcc
gctgcactcatcacttactttgccgggaactggcatagcgtcgccatttatttgctggct
ggatgcctgatttccgcaatgaccgctttgttgatgaaagacagtcaacgcgcttga
              
                            

Download fasta file
RegulonDB