RegulonDB RegulonDB 10.10: Gene Sequence
yeeN gene sequence


Size: 717        A: 236  T: 195  G: 160  C: 126

Fasta

 

>yeeN E. coli K12. Version NC_000913.3 GI:556503834
gtgggacgtaaatgggccaatattgttgctaaaaaaacggctaaagacggtgcaacgtct
aaaatttatgcaaaattcggtgtagaaatctatgctgctgctaaacaaggtgaacccgat
ccagaattaaacacatctttaaaattcgttattgaacgtgcaaagcaggcacaagttcca
aagcacgttattgataaagcaattgataaagccaaaggcggcggagatgaaacgttcgtg
cagggacgttatgaaggctttggtcctaatggctcaatgattatcgccgagacattgact
tcaaatgttaaccgtacgattgctaacgttcgcacaattttcaataaaaaaggcggcaat
atcggagcggcaggttctgtcagctatatgtttgacaatacgggtgtgattgtatttaaa
gggacagaccctgaccatatttttgaaattttacttgaagctgaagttgatgttcgtgat
gtgactgaagaagaaggtaacattgttatttatactgaacctactgaccttcataaagga
atcgcggctctaaaagcagctggaatcactgagttctcaacaacagaattagaaatgatt
gctcaatctgaagttgagctttccccagaagatttagaaatctttgaagggcttgttgat
gcccttgaagatgacgacgatgtacaaaaagtttatcataacgtcgcaaatctctaa
              
                            

Download fasta file
RegulonDB