RegulonDB RegulonDB 11.0: Gene Sequence
yeeO gene sequence


Size: 1644        A: 330  T: 520  G: 457  C: 337

Fasta

 

>yeeO E. coli K12. Version NC_000913.3 GI:556503834
ttgttgaggcacatcttaacggcgaaaaatcttttgtcaaacccgatttttaaattcccc
aactgtttgccgtttctatcaacagtttgttgcatttgcagacaatttgttggcgaaaat
ctttgcagctttgctgattctccctcattatttgaaatgtggtttcactttctgcaatta
aggtcggctttgaatatctcctctgctttacgccaggttgttcacggcactcgctggcac
gctaaacgcaagagctacaaagtgttgttctggcgcgagataaccccgcttgctgttcct
atcttcatggagaatgcctgtgtcctgttgatgggggttctgagcacttttctggtcagc
tggctgggaaaagatgcgatggccggcgtgggattggcggacagcttcaatatggtcatt
atggctttttttgctgctatcgatcttggtactactgtcgttgtggcatttagtctcggt
aagcgggatcgacgacgagcgagggtggcgacgcggcagtcattggtgatcatgacgttg
tttgccgtactgttggcaacgcttattcatcattttggcgaacaaattattgatttcgtc
gcgggtgatgccacgacagaagttaaagcactggcgttgacttatctggagctgacggta
ctcagttatccagcagctgccatcactcttattggtagcggggcacttcgtggtgcaggg
aatacgaaaataccgctattgattaacggtagcctgaatattcttaatattattattagc
ggcatattgatttacggccttttctcctggccgggactgggatttgtcggggcagggctg
ggtttaaccatttctcgttatattggcgcagttgcaattttgtgggtgctggcgattggt
tttaatcctgcgctaaggatttcgttaaagagctattttaaaccgctgaattttagcatt
atctgggaagtcatggggattggtattcccgcgagtgtcgaatcagtgttatttaccagt
ggtcggttattaacccaaatgttcgttgccgggatggggaccagtgttattgccggaaat
tttatcgcgttttcaattgcggctcttatcaacttacccggaagtgcgctcggctctgct
tctacgatcattacaggccgaaggttgggggtagggcagatagcgcaagcagagattcag
ttgcggcatgtgttctggctttccactcttggattaacggccatcgcctggctaacggct
ccctttgccggggttatggcatcgttttacacccaggatccacaggttaaacatgtcgtt
gtgattctgatttggctaaatgctttatttatgcctatttggtccgcctcatgggtgcta
cccgctggatttaaaggtgctcgtgatgcccgttacgccatgtgggtttcgatgttgagc
atgtggggttgtcgggttgtagtcggttatgtgctgggaatcatgcttggctggggtgtg
gttggtgtctggatgggaatgtttgccgactgggctgtgcgggccgtgctgttttactgg
cgaatggttactggacgttggctatggaaataccctcgacccgagccgcaaaagtgtgaa
aaaaagccagttgtgtcggaataa
              
                            

Download fasta file
RegulonDB