RegulonDB RegulonDB 10.9: Gene Sequence
cbl gene sequence


Size: 951        A: 243  T: 249  G: 253  C: 206

Fasta

 

>cbl E. coli K12. Version NC_000913.3 GI:556503834
gtgaatttccaacaactaaagataatccgcgaggctgcacgtcaggattacaacctgaca
gaggttgcgaatatgctttttacctcacagtcaggcgtcagccgtcatattcgggaactg
gaggatgaacttggcatcgaaatatttgttcgacgaggtaagcgactgctgggcatgact
gaaccgggcaaagcattactggtcattgcagaacgtattctgaatgaagccagtaatgtt
cgtcggcttgcagacctgtttaccaacgatacgtctggcgttctcactattgcaacgacg
catactcaggcacgttatagcttgccagaggtcattaaagcttttcgcgaacttttcccg
gaggttcggctcgagctaatccaggggacgccacaggaaattgcgacattgttgcaaaat
ggcgaagctgatattggtatcgccagcgagcgtttgagtaatgacccgcagctcgtcgcc
ttcccgtggtttcgttggcaccatagtttgcttgttccacacgatcatcccttgacgcaa
atttcaccattgacgctggaatcaatagcgaagtggccgttaatcacttaccgacagggg
attacggggcgctcacgtattgatgacgcatttgcccgcaaaggtttgctggcagatatt
gtattaagtgcgcaggattctgatgtcattaaaacctatgttgctcttgggcttgggatc
ggattagttgccgagcaatccagtggcgaacaagaggaagagaatttaatccgcctggat
acgcggcatctttttgatgctaatactgtctggttgggactgaagcgaggacaacttcag
cgtaactatgtctggcgctttctggaactttgtaatgcaggactgtcagttgaggatatc
aagcggcaggtgatggaaagcagtgaagaggaaattgattatcagatatag
              
                            

Download fasta file
RegulonDB