RegulonDB RegulonDB 10.9: Gene Sequence
nac gene sequence


Size: 918        A: 234  T: 242  G: 229  C: 213

Fasta

 

>nac E. coli K12. Version NC_000913.3 GI:556503834
atgaacttcagacgcctgaaatacttcgtaaaaattgtagatattggtagcctgacccag
gctgctgaagtattgcatatcgcacaaccagcgctcagccagcaggttgccacactggaa
ggtgagttaaatcaacaacttttgatccgtacaaagcggggcgttacaccaacagacgcc
ggaaaaattctctatacccatgcgcgggccattttacgtcagtgtgaacaggcccaactg
gcggtgcataacgttggtcaggcattatcggggcaagtctcgattggctttgcaccagga
accgctgcgtcatccatcaccatgcccttattacaggcggttcgcgctgaatttccggag
atcgttatctatcttcatgaaaatagtggtgcagtgcttaacgaaaaattgataaatcac
caactcgatatggcggtgatttatgagcattcccctgtggctggtgtatccagtcaggct
ttgctgaaagaagatctttttctggtaggaactcaagattgcccggggcaaagcgttgat
gtgaatgctattgcgcaaatgaacctctttctccccagtgattacagtgctattagactt
cgtgttgatgaggctttttccctacggcgactcacggcaaaagttattggtgaaattgag
tctattgccacgcttaccgcagcgattgccagcggcatgggcgttgcagtattacccgaa
tcggccgcgcgttcgttatgtggcgcagtaaatgggtggatgtcacgcattaccactcct
tccatgagtctctctttgtcattaaatttacccgccagagcgaacttatcgccacaggca
caggcagtgaaagagttgttaatgtcagtgattagttctccagtgatggaaaaaaggcag
tggcaattggtgagctaa
              
                            

Download fasta file
RegulonDB