RegulonDB RegulonDB 10.9: Gene Sequence
ldtA gene sequence


Size: 933        A: 223  T: 247  G: 240  C: 223

Fasta

 

>ldtA E. coli K12. Version NC_000913.3 GI:556503834
atgcgtcgtgtaaatattctttgctcatttgctctgctttttgccagccatactagcctg
gcggtaacttatccattacctccagagggtagccgtttagtggggcagtcgtttactgta
actgttcctgatcacaatacccagccgctggagacttttgccgcacaatacgggcaaggg
ttaagtaacatgctggaagcgaacccgggcgctgatgtttttttgccgaagtctggctcg
caactcaccattccgcagcaactgattttgcccgacactgttcgtaaagggattgttgtt
aacgtcgctgagatgcgtctttattactacccaccagacagtaatactgtggaagtcttt
cctattggtatcggccaggctgggcgagaaaccccgcgtaactgggtgactaccgttgaa
cgtaaacaagaagctccaacctggacgccaacgccgaacactcggcgcgaatatgcgaaa
cgaggggagagtttgcccgcatttgttcctgcgggccccgataatcccatggggctgtac
gcgatttatattggcaggttgtatgccatccatggtaccaatgccaattttggtattggg
ctccgggtaagtcagggctgtattcgtctgcgcaatgacgatatcaaatatctgtttgat
aatgttcctgttgggacgcgtgtgcaaattatcgaccagccagtaaaatacaccactgaa
ccagatggctcgaactggctggaagttcatgagccattgtcgcgcaatcgtgcagaatat
gagtctgaccgaaaagtgccattgccggtaaccccatctttgcgggcgtttatcaacggg
caagaagttgatgtaaatcgcgcaaatgctgcgttgcaacgtcgatcgggaatgcctgtg
caaattagttctggttcaagacagatgttttaa
              
                            

Download fasta file
RegulonDB