RegulonDB RegulonDB 10.9: Gene Sequence
insH6 gene sequence


Size: 981        A: 260  T: 182  G: 261  C: 278

Fasta

 

>insH-6 E. coli K12. Version NC_000913.3 GI:556503834
atgtttgtcatctggagccatggaacagggttcatcatgagtcatcaacttaccttcgcc
gacagtgaattcagcagtaagcgccgtcagaccagaaaagagattttcttgtcccgcatg
gagcagattctgccatggcaaaacatggtggaagtcatcgagccgttttaccccaaggct
ggtaatggccggcgaccttatccgctggaaaccatgctacgcattcactgcatgcagcat
tggtacaacctgagcgatggcgcgatggaagatgctctgtacgaaatcgcctccatgcgt
ctgtttgcccggttatccctggatagcgccttgccggaccgcaccaccatcatgaatttc
cgccacctgctggagcagcatcaactggcccgccaattgttcaagaccatcaatcgctgg
ctggccgaagcaggcgtcatgatgactcaaggcaccttggtcgatgccaccatcattgag
gcacccagctcgaccaagaacaaagagcagcaacgcgatccggagatgcatcagaccaag
aaaggcaatcagtggcactttggcatgaaggcccacattggtgtcgatgccaagagcggc
ctgacccacagcctagtcaccaccgcggccaacgagcatgacctcaatcagctgggtaat
ctgctgcatggagaggagcaatttgtctcagccgatgccggctaccaaggggcgccacag
cgcgaggagctggccgaggtggatgtggactggctgatcgccgagcgccccggcaaggta
agaaccttgaaacagcatccacgcaagaacaaaacggccatcaacatcgaatacatgaaa
gccagcatccgggccaaggtggagcacccatttcgcatcatcaagcgacagttcggcttc
gtgaaagccagatacaaggggttgctgaaaaacgataaccaactggcgatgttattcacg
ctggccaacctgtttcgggcggaccaaatgatacgtcagtgggagagatctcactaa
              
                            

Download fasta file
RegulonDB