RegulonDB RegulonDB 10.9: Gene Sequence
yoeA gene sequence


Size: 504        A: 142  T: 132  G: 115  C: 115

Fasta

 

>yoeA E. coli K12. Version NC_000913.3 GI:556503834
atgttatataatataccttgtcgaatttatatcctttccactctgtcattatgcatttct
gggatagtttctactgcaaccgcaacttcttcagaaacaaaaatcagcaacgaagagacg
ctcgtcgtgaccacgaatcgttcggcaagcaacctttgggaaagcccggcgactatacag
gttattgaccaacaaacattgcagaactccaccaatgcctccatagccgataatttgcag
gacatccccggagtagagataacagacaactccttggcaggccgtaaacaaatccgcatt
cgtggcgaagcatcctcccgtgttttaattctcattgatggtcaggaggtaacttatcag
cgcgccggagataattatggtgtgggactgttgatagatgagtctgcgctggagcgtgtt
gaggtagtgaaaggtccatattccgtactgtacggttcacaggcaattggcggtattgtt
aacttcatcaccaaaaagggtgaa
              
                            

Download fasta file
RegulonDB