RegulonDB RegulonDB 10.10: Gene Sequence
yoeA gene sequence


Size: 1840        A: 426  T: 474  G: 435  C: 505

Fasta

 

>yoeA E. coli K12. Version NC_000913.3 GI:556503834
atgttatataatataccttgtcgaatttatatcctttccactctgtcattatgcatttct
gggatagtttctactgcaaccgcaacttcttcagaaacaaaaatcagcaacgaagagacg
ctcgtcgtgaccacgaatcgttcggcaagcaacctttgggaaagcccggcgactatacag
gttattgaccaacaaacattgcagaactccaccaatgcctccatagccgataatttgcag
gacatccccggagtagagataacagacaactccttggcaggccgtaaacaaatccgcatt
cgtggcgaagcatcctcccgtgttttaattctcattgatggtcaggaggtaacttatcag
cgcgccggagataattatggtgtgggactgttgatagatgagtctgcgctggagcgtgtt
gaggtagtgaaaggtccatattccgtactgtacggttcacaggcaattggcggtattgtt
aacttcatcaccaaaaagggtgaa
              
                            

Download fasta file
RegulonDB