RegulonDB RegulonDB 10.9: Gene Sequence
insD3 gene sequence


Size: 906        A: 214  T: 193  G: 283  C: 216

Fasta

 

>insD-3 E. coli K12. Version NC_000913.3 GI:556503834
gtggatagcgcacgcgcccttattgcccggggatggggagtaagcttagtcagccgttgt
ctccgggtgtcgcgtgcgcagttgcacgtcattctcagacgaaccgatgactggatggat
ggccgccgcagtcgtcacactgatgatacggatgtgcttctccgtatacaccatgttatc
ggagagctgccaacgtatggttatcgtcgggtatgggcgctgcttcgcagacaggcagaa
cttgatggtatgcctgcgatcaatgccaaacgtgtttaccggatcatgcgccagaatgcg
ctgttgcttgagcgaaaacctgctgtaccgccatcgaaacgggcacatacaggcagagtg
gccgtgaaagaaagcaatcagcgatggtgctctgacgggttcgagttctgctgtgataac
ggagagagactgcgtgtcacgttcgcgctggactgctgtgatcgtgaggcactgcactgg
gcggtcactaccggcggcttcaacagtgaaacagtacaggacgtcatgctgggagcggtg
gaacgccgcttcggcaacgatcttccgtcgtctccagtggagtggctgacggataatggt
tcatgctaccgggctaatgaaacacgccagttcgcccggatgttgggacttgaaccgaag
aacacggcggtgcggagtccggagagtaacggaatagcagagagcttcgtgaaaacgata
aagcgtgactacatcagtatcatgcccaaaccagacgggttaacggcagcaaagaacctt
gcagaggcgttcgagcattataacgaatggcatccgcatagtgcgctgggttatcgctcg
ccacgggaatatctgcggcagcgggcttgtaatgggttaagtgataacagatgtctggaa
atatag
              
                            

Download fasta file
RegulonDB