RegulonDB RegulonDB 10.9: Gene Sequence
yeeP gene sequence


Size: 426        A: 76  T: 94  G: 132  C: 124

Fasta

 

>yeeP E. coli K12. Version NC_000913.3 GI:556503834
gtggtgacgcaggccgacaaaacggagccctgccatgaatgggatatggccggtattcag
ccttctcctgcacaggcacagaatattcgcgaaaaaacggaggcggtattccgtctgttc
cggcccgtacatccggttgtggccgtatcggcccgcaccggctgggaactggatacgctg
gtcagtgcgctcatgacagcgcttcccgaccatgccgccagtcccctgatgacccgactg
caggacgagctgcgcacggaatctgtccggtctcaggcccgtgaacagtttaccggtgcg
gtggaccggatatttgacacggcggagagcgtctgtattgcctctgttgcacgcacggtt
ctgcgtgccgtccgtgacacggtggtctctgttgcccgtgcggtatggaactggattttc
ttctga
              
                            

Download fasta file
RegulonDB