RegulonDB RegulonDB 10.9: Gene Sequence
flu gene sequence


Size: 3120        A: 730  T: 573  G: 970  C: 847

Fasta

 

>flu E. coli K12. Version NC_000913.3 GI:556503834
atgaaacgacatctgaatacctgctacaggctggtatggaatcacatgacgggcgctttc
gtggttgcctccgaactggcccgcgcacggggtaaacgtggcggtgtggcggttgcactg
tctcttgccgcagtcacgtcactcccggtgctggctgctgacatcgttgtgcacccggga
gaaaccgtgaacggcggaacactggcaaatcatgacaaccagattgtcttcggtacgacc
aacggaatgaccatcagtaccgggctggagtatgggccggataacgaggccaataccggc
gggcaatgggtacaggatggcggaacagccaacaaaacgactgtcaccagtggtggtctt
cagagagtgaaccccggtggaagtgtctcagacacggttatcagtgccggaggcggacag
agccttcagggacgggctgtgaacaccacgctgaatggtggcgaacagtggatgcatgag
ggggcgatagccacaggaaccgtcattaatgataagggctggcaggtcgtcaagcccggt
acagtggcaacggataccgttgttaataccggggcggaagggggaccggatgcagaaaac
ggtgataccgggcagtttgttcgcggggatgccgtacgcacaaccatcaataaaaacggt
cgccagattgtgagagctgaaggaacggcaaataccactgtggtttatgccggcggcgac
cagactgtacatggtcacgcactggataccacgctgaatgggggataccagtatgtgcac
aacggcggtacagcgtctgacactgttgtgaacagtgacggctggcagattgtcaaaaac
gggggtgtggccgggaataccaccgttaatcagaagggcagactgcaggtggacgccggt
ggtacagccacgaatgtcaccctgaagcagggcggcgcactggttaccagtacggctgca
accgttaccggcataaaccgcctgggagcattctctgttgtggagggtaaagctgataat
gtcgtactggaaaatggcggacgcctggatgtgctgaccggacacacagccactaatacc
cgcgtggatgatggcggaacgctggatgtccgcaacggtggcaccgccaccaccgtatcc
atgggaaatggcggtgtactgctggccgattccggtgccgctgtcagtggtacccggagc
gacggaaaggcattcagtatcggaggcggtcaggcggatgccctgatgctggaaaaaggc
agttcattcacgctgaacgccggtgatacggccacggataccacggtaaatggcggactg
ttcaccgccaggggcggcacactggcgggcaccaccacgctgaataacggcgccatactt
accctttccgggaagacggtgaacaacgataccctgaccatccgtgaaggcgatgcactc
ctgcagggaggctctctcaccggtaacggcagcgtggaaaaatcaggaagtggcacactc
actgtcagcaacaccacactcacccagaaagccgtcaacctgaatgaaggcacgctgacg
ctgaacgacagtaccgtcaccacggatgtcattgctcagcgcggtacagccctgaagctg
accggcagcactgtgctgaacggtgccattgaccccacgaatgtcactctcgcctccggt
gccacctggaatatccccgataacgccacggtgcagtcggtggtggatgacctcagccat
gccggacagattcatttcacctccacccgcacagggaagttcgtaccggcaaccctgaaa
gtgaaaaacctgaacggacagaatggcaccatcagcctgcgtgtacgcccggatatggca
cagaacaatgctgacagactggtcattgacggcggcagggcaaccggaaaaaccatcctg
aacctggtgaacgccggcaacagtgcgtcggggctggcgaccagcggtaagggtattcag
gtggtggaagccattaacggtgccaccacggaggaaggggcctttgtccaggggaacagg
ctgcaggccggtgcctttaactactccctcaaccgggacagtgatgagagctggtatctg
cgcagtgaaaatgcttatcgtgcagaagtccccctgtatgcctccatgctgacacaggca
atggactatgaccggattgtggcaggctcccgcagccatcagaccggtgtaaatggtgaa
aacaacagcgtccgtctcagcattcagggcggtcatctcggtcacgataacaatggcggt
attgcccgtggggccacgccggaaagcagcggcagctatggattcgtccgtctggagggt
gacctgatgagaacagaggttgccggtatgtctgtgaccgcgggggtatatggtgctgct
ggccattcttccgttgatgttaaggatgatgacggctcccgtgccggcacggtccgggat
gatgccggcagcctgggcggatacctgaatctggtacacacgtcctccggcctgtgggct
gacattgtggcacagggaacccgccacagcatgaaagcgtcatcggacaataacgacttc
cgcgcccggggctggggctggctgggctcactggaaaccggtctgcccttcagtatcact
gacaacctgatgctggagccacaactgcagtatacctggcagggactttccctggatgac
ggtaaggacaacgccggttatgtgaagttcgggcatggcagtgcacaacatgtgcgtgcc
ggtttccgtctgggcagccacaacgatatgacctttggcgaaggcacctcatcccgtgcc
cccctgcgtgacagtgcaaaacacagtgtgagtgaattaccggtgaactggtgggtacag
ccttctgttatccgcaccttcagctcccggggagatatgcgtgtggggacttccactgca
ggcagcgggatgacgttctctccctcacagaatggcacatcactggacctgcaggccgga
ctggaagcccgtgtccgggaaaatatcaccctgggcgttcaggccggttatgcccacagc
gtcagcggcagcagcgctgaagggtataacggtcaggccacactgaatgtgaccttctga
              
                            

Download fasta file
RegulonDB