RegulonDB RegulonDB 11.0: Gene Sequence
yeeR gene sequence


Size: 1533        A: 387  T: 375  G: 403  C: 368

Fasta

 

>yeeR E. coli K12. Version NC_000913.3 GI:556503834
atgttacagatagtcggcgcgctgatcctgctgatcgcaggatttgccattcttcgcctt
ttgttcagagcattaatcagcacggcttctgcgctggcagggctcatattgctgtgtctg
ttcggcccggccttactggctggctatatcaccgaacgcataacccggttgttccatatt
cgctggctggcaggcgtatttctgacgattgccggaatgatcatcagcttcatgtgggga
cttgatggtaaacatatcgcgctggaggctcacacctttgactctgtgaaatttattctg
accaccgctctcgccggtggtctgctggctgttcccctgcagatcaaaaacattcagcag
aacgggatcacaccagaagatatcagcaaggaaattaacgggtattactgctgtttttat
actgcctttttccttatggcgtgttctgcatgcgcaccattgatcgcgttacagtacgat
atttcaccgtcactgatgtggtggggcgggttgttgtactggctggctgcattagtgacg
ctgctatgggcggccagccagatccaggcgctgaaaaaactgacctgtgccatcagccag
acactggaagaacaaccggtgctcaacagtaaatcgtggctgaccagtttgcaaaacgat
tacagccttcctgactcactgacggagcgcatctggctgacgctcatttctcaacggatt
tcccggggagagctgagggaatttgaactggcagacggaaactggttactgaacaatgcc
tggtatgaaagaaacatggcagggtttaacgaacagttgaaagagaacctgtcattcaca
cctgatgaactgaaaacgctcttccggaaccgcctgaatttatcaccggaagcgaatgac
gattttctcgatcgttgcctggacggcggtgactggtatcccttttcagaaggtcgccgt
tttgtatcattccatcacgtggatgagcttcgtatctgtgcctcctgcgggctgacagaa
gtacatcatgccccggaaaatcataagccggatccggaatggtactgctcctctctttgt
cgcgaaacagaaacactgtgtcaggaaatttatgaacgcccttacaacagctttatttcc
gatgcaacggcgaatggtctgattctcatgaaactgccggaaacctggagtacaaatgag
aaaatgtttgcttccggagggcagggacatgggtttgccgctgaacggggaaaccatatt
gtcgacagagtccgtctgaaaaacgcacggatcctcggtgataataatgccagaaatgga
gcagacagactggtcagcggaacagaaatccagacgaaatattgttcaactgcagcccgt
agcgtcggtgcggcattcgacggacaaaacggacagtatcgttacatgggaaataatggc
cccatgcaactggaagtcccccgtgatcagtatgccggcgctgttgaaaccatgaggaat
aagatccgcgaaggtaaagtagaggagagatga
              
                            

Download fasta file
RegulonDB