RegulonDB RegulonDB 10.9: Gene Sequence
yeeT gene sequence


Size: 222        A: 48  T: 57  G: 59  C: 58

Fasta

 

>yeeT E. coli K12. Version NC_000913.3 GI:556503834
atgaaaattatcacccgtggtgaagccatgcgtattcaccaacaacatccgacatcccgt
ctttttccgttctgtaccggtaaataccgctggcacggcagtgctgaagcgtataccggt
cgtgaagtgcaggatattcccggtgtgctggccgtgtttgctgaacgccgtaaggacagt
tttggtccgtatgtccggctgatgagcgtcaccctgaactga
              
                            

Download fasta file
RegulonDB