RegulonDB RegulonDB 10.10: Gene Sequence
cbeA gene sequence


Size: 369        A: 83  T: 75  G: 96  C: 115

Fasta

 

>cbeA E. coli K12. Version NC_000913.3 GI:556503834
gtgtcagacacactccccgggacaacacttcccgacgacaatcacgaccgcccctggtgg
gggctgccctgcaccgtgacgccctgtttcggggcacgtctggtgcaggagggtaaccgg
ttgcattaccttgccgaccgcgccggtatcagaggcctgttcagcgatgcagatgcgtac
cacctggaccaggcctttccgctgctgatgaaacaactggaactcatgctcaccagcggt
gaactgaatccccgccatcagcataccgtcacgctgtatgcaaaagggctgacctgcaaa
gccgataccctcagcagttgtgattacgtttatctggctgtttatccgacgcccgaaatg
aaaaattaa
              
                            

Download fasta file
RegulonDB