RegulonDB RegulonDB 10.10: Gene Sequence
cbtA gene sequence


Size: 375        A: 92  T: 84  G: 97  C: 102

Fasta

 

>cbtA E. coli K12. Version NC_000913.3 GI:556503834
atgaaaacattacctgtattacccgggcaggcggccagttctcgcccgtctcctgttgaa
atctggcagatactgctgtcccgactgctggaccagcactatggcctcacactgaatgac
acaccttttgccgatgaacgtgtgattgagcagcatattgaggcaggcatttcactgtgt
gatgcggtgaactttctcgtggaaaaatacgcgctggtgcgtaccgaccagccgggattc
agcgcctgtacccgctctcagttaataaacagcatcgatatcctccgggctcgcagggcg
accggcctgatgacccgcgacaattacagaacggtaaataacattaccctgggtaagtat
ccggaggcgaaatga
              
                            

Download fasta file
RegulonDB