RegulonDB RegulonDB 10.10: Gene Sequence
yeeW gene sequence


Size: 195        A: 52  T: 47  G: 50  C: 46

Fasta

 

>yeeW E. coli K12. Version NC_000913.3 GI:556503834
atgatgacactggaagccgacagcgttaacgtacaggcgctggatatggggcacattgtc
gttgacattgatggtgttaatatcactgaactgattaataaggccgctgaaaacggttat
tcactccgcgtggtggatgaccgtgactctaccgaaacaccggcaacttatgccagccct
caccagttgctgtaa
              
                            

Download fasta file
RegulonDB