RegulonDB RegulonDB 10.9: Gene Sequence
wzxC gene sequence


Size: 1479        A: 289  T: 390  G: 443  C: 357

Fasta

 

>wzxC E. coli K12. Version NC_000913.3 GI:556503834
atgagcttacgtgaaaaaaccatcagcggcgcgaagtggtcggcgattgccacggtgatc
atcatcggcctcgggctggtgcagatgaccgtgctggcgcggattatcgacaaccaccag
ttcggcctgcttaccgtgtcgctggtgattatcgcgctggcagatacgctttctgacttc
ggtatcgctaactcgattattcagcgaaaagaaatcagtcaccttgaactcaccacgttg
tactggctgaacgtcgggctggggatcgtggtgtgcgtggcggtgtttttgttgagtgat
ctcatcggcgacgtgctgaataacccggacctggcaccgttgattaaaacattatcgctg
gcgtttgtggtaatcccccacgggcaacagttccgcgcgttgatgcaaaaagagctggag
ttcaacaaaatcggcatgatcgaaaccagcgcggtgctggcgggcttcacttgtacggtg
gttagcgcccatttctggccgctggcgatgaccgcgatcctcggttatctggtcaatagt
gcggtgagaacgctgctgtttggctactttggccgcaaaatttatcgccccggtctgcat
ttctcgctggcgtcggtggcaccgaacttacgctttggtgcctggctgacggcggacagc
atcatcaactatctcaataccaacctttcaacgctcgtgctggcgcgtattctcggcgcg
ggcgtggcagggggatacaacctggcgtacaacgtggccgttgtgccaccgatgaagctg
aacccaatcatcacccgcgtgttgtttccggcattcgccaaaattcaggacgataccgaa
aagctgcgtgttaacttctacaagctgctgtcggtagtggggattatcaactttccggcg
ctgctcgggctaatggtggtgtcgaataactttgtaccgctggtctttggtgagaagtgg
aacagcattattccggtgctgcaattgctgtgtgtggtgggtctgctgcgctccgtaggt
aacccgattggttcgctgctgatggcgaaagcgcgggtcgatatcagctttaaattcaac
gtattcaaaacatttctgtttattccggcgattgttataggtgggcagatggcgggcgcg
atcggcgtcacgcttggcttcctgctggtgcaaattatcaacaccattctgagttacttc
gtgatgattaaaccggttcttggttccagttatcgccagtacatcctgagtttatggctg
ccgttttatctctcgctgccgacgctggtggtcagttatgcgctgggcattgtgctgaaa
gggcaactggcgctggggatgctgctggcggtgcaaatagccacgggggtgctggcgttt
gtggtgatgattgtgctgtcgcgccatccgctggtggtggaagtgaagcgtcagttttgt
cgcagcgaaaaaatgaaaatgcttttacgggcggggtga
              
                            

Download fasta file
RegulonDB