RegulonDB RegulonDB 10.9: Gene Sequence
wcaJ gene sequence


Size: 1395        A: 312  T: 321  G: 413  C: 349

Fasta

 

>wcaJ E. coli K12. Version NC_000913.3 GI:556503834
atgacaaatctaaaaaagcgcgagcgagcgaaaaccaatgcatcgttaatctctatggtg
caacgcttttcagatatcaccatcatgtttgccggactatggctggtttgcgaagtcagc
ggactgtcattcctctacatgcacctgttggtggcgctgattacgctggtggtgttccag
atgctgggcggcatcaccgatttttatcgctcatggcgcggtgttcgggcagcgacagaa
tttgccctgttgctacaaaactggaccttaagcgtgattttcagcgccggactggtggcg
ttcaacaatgatttcgacacgcaactgaaaatctggctggcgtggtatgcgctgaccagc
atcggactggtggtttgccgttcgtgtattcgcattggggcgggctggctgcgtaatcat
ggctataacaagcgcatggtcgcggtggcgggggatttagccgccgggcaaatgctgatg
gagagcttccgtaaccagccgtggttagggtttgaagtggtgggcgtttaccacgacccg
aaaccgggcggcgtttctaacgactgggcgggtaacctgcaacagctggtcgaggacgcg
aaagcgggcaagattcataacgtctatatcgcgatgcaaatgtgcgacggcgcgcgagtg
aaaaaactggtccatcaactggcggacaccacctgttcggtgctgctgatccccgacgtc
tttaccttcaacattctccattcacgcctcgaagagatgaacggcgtaccggtggtgccg
ctttacgacacgccgctttccggggttaaccgcctgctcaaacgtgcggaagacattgtg
ctggcgacgcttattctgctgctgatctccccggtgctgtgctgtattgcgctggcggtg
aaactcagttcaccagggccggttattttccgccagactcgctacggcatggatggcaag
ccgatcaaagtgtggaagttccgttccatgaaagtgatggagaacgacaaagtggtgacc
caggcgacgcagaacgatccgcgcgtcaccaaagtggggaactttctgcgccgtacctcg
ctggatgaattgccgcagtttatcaatgtgctgaccggggggatgtcgattgtcggtcca
cgtccgcacgcagtagcgcataacgaacagtatcgacagctcattgaaggctacatgctg
cgccataaggtgaaaccgggcattaccggctgggcgcagattaacggctggcgcggcgaa
accgacacgctggagaaaatggaaaaacgcgtcgagttcgaccttgagtacatccgcgaa
tggagcgtctggttcgatatcaaaatcgttttcctgacggtgttcaaaggtttcgttaac
aaagcggcatattga
              
                            

Download fasta file
RegulonDB