RegulonDB RegulonDB 10.9: Gene Sequence
wcaF gene sequence


Size: 549        A: 144  T: 142  G: 144  C: 119

Fasta

 

>wcaF E. coli K12. Version NC_000913.3 GI:556503834
atgcaagatttaagcggtttctcggtgccgaaagggttccggggcggcaacgctattaaa
gtgcaattatggtgggcagtacaggcaacaatatttgcctggtcgccacaagtattgtat
cgctggcgggcttttttattacgtttattcggagcaaaaataggaaaaaacgtagttatt
cgtccgtcagtaaaaattacctatccgtggaaattaaccttaggtgattacgcgtgggtc
ggcgatgacgtcaatttatataccctcggtgaaataaccattggcgcacattcggtgata
tcgcaaaaaagttatttatgcaccggtagccacgaccatgcaagtcaacatttcaccatt
aacgccacgcctattgtgattggcgagaaatgctggctggcaaccgatgtctttgttgcc
ccaggcgtcacaatcggcgacggcaccgtcgtgggtgcacgaagcagtgtttttaaatcg
cttccggcaaatgtggtttgccgggggaatcccgcagtggtgatacgcgaacgcgttgaa
actgaataa
              
                            

Download fasta file
RegulonDB