RegulonDB RegulonDB 10.8: Gene Sequence
wcaE gene sequence


Size: 747        A: 210  T: 197  G: 175  C: 165

Fasta

 

>wcaE E. coli K12. Version NC_000913.3 GI:556503834
atgttgcttagcataatcactgtcgcgtttcgtaacctcgaagggatagtcaaaacacat
gcctcgctggcgcatctggcgcaggtggaagatatcagcttcgaatggattgttgtcgat
ggcggttccaacgacggcacccgtgagtatctggaaaatctcaatggtatctttaaccta
cgctttgtcagcgagccagataacggtatctacgacgccatgaacaaaggcattgcgatg
gcacaaggcaagttcgcgttgtttctcaattcgggcgatatttttcatcagaatgccgca
aattttgtccgtaagttaaaaatgcaaaaagataacgtgatgatcaccggcgatgcgctg
ctggattttggcgacgggcataaaattaaacgtagcgccaaaccgggctggtatatttat
cacagcctgcccgccagtcatcaggcgatatttttccctgtatccggcttgaaaaaatgg
cgttatgacctggaatataaagtttcttccgactacgcgctggcagccaaaatgtataaa
gccggttatgcatttaaaaaactcaatggcctggtgtctgaattttccatgggtggggta
tctaccaccaataatatggaattgtgtgctgacgcgaaaaaagtccaacgacaaatatta
catgtgcctggcttttgggctgaattatcctggcatttacgccaacgtactacctcaaag
acgaaagccttatataacaaagtctga
              
                            

Download fasta file
RegulonDB