RegulonDB RegulonDB 10.8: Gene Sequence
wcaD gene sequence


Size: 1218        A: 287  T: 419  G: 277  C: 235

Fasta

 

>wcaD E. coli K12. Version NC_000913.3 GI:556503834
atgtcaacttctatcagaatctgtagctacctgttgctgccgctgatttatctgctggtt
aacgtcaaaatcgcccagcttggcgaaagtttccccatcaccatcgtcacttttttacct
gtcttgttactgctgtttttagaacgcatcagcgttaaaaaattgatgattgccttaggg
attggcgcgggactcacggcgtttaactatctgtttggtcagtcgctggatgccagtaaa
tacgtcacttcaactatgctgtttgtctatattgtgatcattattggcatggtgtggagt
attcgttttaaaacaatttcgccacacaaccatcgcaagatattacgtttcttttatctg
gtggtcgggctggtggtggcgctggcggcggtggagatggcacaaattatcctcaccggt
ggcagcagtattatggagtcgatttcgaaatatctgatttacagcaacagctatgtgctg
aatttcattaaattcggcggcaagcgcacgacagcactttatttcgaaccggcatttttc
gctctggcattaatctcaatttggctcagcatcaaacagtttggtatcaaaacgcctaaa
acagatgctatgattctcgcagggataatattatccggatcgttttcaggggttatgacc
tttatcctgttttatttgctggagtgggcatttcaatatctgaataaagaggcgattaag
aaaaagttaccgttagcattgatttctctggctgtattcctggttggtgtggtaatcgcg
tttccttatatttccacccgtctgggcgatttaggtacggaaggatcgtcatcatattat
cgtattgtcggtccgctggtgatggtcggttattctttgacccatattgacggtgtagtc
agatttggctcactttatgaatatgtcgcatcattcggaatatttaacggtgcggatgtc
ggaaaaaccatagacaatggtttgtatctgctgattatttatttttcctggttcgcggtg
tttttatcactgtggtacatggggaaagtgataaaaatgatgatcaacgcttttggtgat
aaccgcaattttcgcgtgcaattatatctttttactccggtatcgctgttttttaccggt
tcgatatttagcccggaatatgcatttttaatcgtctgtccgtttattttgcgaaaagcg
ttaaatattacgaggtaa
              
                            

Download fasta file
RegulonDB