RegulonDB RegulonDB 10.8: Gene Sequence
wcaC gene sequence


Size: 1218        A: 291  T: 274  G: 350  C: 303

Fasta

 

>wcaC E. coli K12. Version NC_000913.3 GI:556503834
atgaatattttgcaatttaatgtgcgactggcggaaggcggggcagcaggtgtggcgtta
gatctccaccagcgtgcgctgcaacaggggctggcgtcacattttgtctacggttacggc
aaaggcggcaaagagagcgtcagccatcagaactatccgcaggtcatcaaacatacgccg
cggatgaccgcgatggcgaatattgctctgtttcgtctgtttaatcgcgatctgtttggc
aatttcaatgagttatatcgcaccattactcgcacagcgggtccggtggtcctgcatttt
catgtgctgcacagctactggctaaatcttaagagcgtggtgcgcttttgcgaaaaagtg
aaaaaccataaaccggacgtcactctggtctggacgctgcacgaccactggagtgttacc
ggacgctgcgcctttaccgacggttgcgaaggctggaaaacaggctgccagaaatgcccg
accttaaataactatccgccggtgaagattgatcgcgcacaccaactggtggcgggcaaa
cgccagttattccgtgagatgctggcgctgggctgtcagtttatttcccccagccagcat
gtggctgacgctttcaatagcctgtacggtccagggcgttgccggattatcaataatggc
attgatatggcaactgaagcgattctggcggacttgcctccggtgcgcgaaacccagggc
aagccgaaaatcgcggtggtggcgcatgatctgcgttacgacggcaaaactaaccagcaa
ctggtacgcgagatgatggcgctgggcgacaaaattgaactgcatacctttggtaagttc
tcgccgttcaccgctggcaacgtggttaatcacggctttgaaaccgacaaacgtaagctg
atgagcgcgctcaatcagatggatgcgctggtattcagttctcgcgtcgataactacccg
ctgattttgtgtgaggcgctatcgattggcgtgccggtgattgccacccatagcgatgcg
gcgcgggaagtgttgcaaaaatccggcggtaaaaccgtcagcgaagaagaggtgctgcaa
ctggtgcagttaagcaaaccggaaatcgcgcaggcgatatttggtaccacgctggctgag
ttcagccaacgcagccgcgccgcctacagtggacaacagatgctggaggagtatgtcaac
ttctatcagaatctgtag
              
                            

Download fasta file
RegulonDB