RegulonDB RegulonDB 10.8: Gene Sequence
wcaB gene sequence


Size: 489        A: 103  T: 122  G: 139  C: 125

Fasta

 

>wcaB E. coli K12. Version NC_000913.3 GI:556503834
atgctggaagatctgcgcgccaacagctggagtttacgcccgtgctgcatggttcttgcc
tatcgtgttgctcatttttgttcggtgtggcgcaaaaagaacgtcctcaacaatctgtgg
gcggccccgctgctggtgctgtatcgcattatcaccgaatgctttttcggttatgaaatc
caggctgccgcgaccattggccgccgctttactatccatcacggttacgccgtcgtgatc
aataaaaacgtggtagcgggggatgattttaccattcgccacggcgtcactatcggcaat
cgtggtgccgataacatggcatgtccacacattggcaacggcgtcgaactcggtgccaac
gtcattattcttggtgatatcacgcttggtaacaacgtcaccgtgggcgcgggcagcgtg
gtgctcgactctgtcccggacaacgcgctggtggtgggagaaaaagcgcgagtgaaggta
attaaatga
              
                            

Download fasta file
RegulonDB