RegulonDB RegulonDB 10.8: Gene Sequence
wcaA gene sequence


Size: 840        A: 226  T: 181  G: 202  C: 231

Fasta

 

>wcaA E. coli K12. Version NC_000913.3 GI:556503834
atgaaaaacaatccgctgatctcaatctatatgccgacctggaaccgccaacaactggcg
attcgggcaataaaatcggttttgcgccaggactacagcaactgggagatgatcatcgtg
gatgattgctccacctcctgggaacaactgcaacagtacgtcaccgccctcaacgatccg
cgtatcacttacattcacaacgacattaacagcggggcgtgcgcggtacgtaaccaggcg
attatgctggcgcaaggggaatatatcaccgggattgatgacgatgacgaatggacaccc
aaccgtctgagcgtcttcctcgcccataaacagcaactggtcacacacgcctttttgtac
gctaacgactacgtttgccagggcgaagtctattcccaaccggcaagcttgccgctgtat
cccaaatcgccgtattcacgccgcctgttctacaaacgcaatatcattggcaaccaggtc
tttacctgggcatggcgtttcaaagagtgtttgttcgataccgaactgaaagcggcacag
gattacgacatcttcctgcggatggtggtggagtacggcgaaccgtggaaagtagaagag
gcgacgcagatcctgcatatcaatcacggtgaaatgcagatcacctcgtcaccgaaaaaa
ttctccgggtacttccacttttaccgcaagcacaaagacaaattcgaccgcgccagcaaa
aaatatcagctgtttaccctctaccagatccgcaataaacgtatgacctggcgcactttg
ctgacgctgctgtcggtgcgtaacggcaaacgtctggctgatggtattcgggggcgctaa
              
                            

Download fasta file
RegulonDB