RegulonDB RegulonDB 10.9: Gene Sequence
wzc gene sequence


Size: 2163        A: 562  T: 462  G: 598  C: 541

Fasta

 

>wzc E. coli K12. Version NC_000913.3 GI:556503834
atgacagaaaaagtaaaacaacatgccgctccggtaacgggcagtgatgaaatcgatatt
ggtcgcctggtcggcaccgtcattgaagcgcgctggtgggtgattggcatcaccaccgta
ttcgccctctgtgccgtggtttacaccttcttcgccacgccgatttatagtgccgacgca
ctggtacaaatcgagcaaaacagcggcaattcgttagtgcaggacattggttcggcatta
gccaacaaaccgcctgcatcggacgccgagatccagttgattcgttcgcgtctggtgctt
ggtaaaacggtggacgatctcgacctcgatattgcagtgagcaaaaacacgttcccgatt
ttcggtgcgggctgggatcgcctgatgggacgtcagaacgagacggtgaaagtgaccacc
tttaaccgcccgaaagagatggcggatcaggtgtttacgcttaatgtgctggacaacaaa
aactacaccctgagcagcgacggcggctttagcgcccgggggcaagcgggccagatgctg
aaaaaagaaggcgtcacgctgatggttgaagccattcacgccagcccgggcagtgagttt
accgtcaccaaatactccacgctggggatgatcaaccaactgcaaaacagcctgacggta
acggagaacggcaaagacgctggcgttttgagcctgacttataccggtgaagatcgtgaa
cagatccgcgacattcttaacagcatcgcccgtaactatcaggaacaaaatattgagcgc
aaatcggcggaagcgtcgaaaagcctcgccttcctcgcgcaacagttaccggaagtacgt
agccgcttggatgttgccgaaaacaaactgaatgccttccgtcaggataaagattctgtt
gatctgccgctggaagcaaaagcggtgctcgattcgatggtgaacatcgatgcgcagttg
aacgaactgacctttaaagaggcggaaatctccaagctgtacaccaaagttcacccggcg
taccgcacgctgctggagaaacgtcaggcgctggaagacgaaaaagccaaacttaacggt
cgcgtaacggcgatgccgaaaacccagcaggagattgtccgtctgacccgcgatgtcgag
tctggtcagcaggtctatatgcaactgctgaataaagagcaggagctgaaaatcaccgag
gccagcaccgtcggcgatgtgcgcattgttgacccggcaatcactcagcctggcgtgctg
aaaccgaagaaagggctgattatcctcggcgcgattatccttggcctgatgctttctatc
gtgggtgtgctgctgcgctcgttgtttaatcgcggcattgaaagcccgcaagtactggaa
gaacacggtattagcgtctatgccagcatcccgctgtcggaatggcagaaagcgcgtgat
agcgtcaaaaccatcaaagggattaaacgctataaacagagccagctactggcggtgggg
aatccaaccgatctggcgattgaagccatccgtagtctgcgtaccagtttgcacttcgcg
atgatgcaggcacagaacaatgtgttgatgatgaccggggttagcccgtcaattggtaaa
acctttgtctgcgccaacctggcggcggtgatcagccagaccaataaacgcgtgttgttg
atcgactgcgatatgcgcaaaggctacacccacgagctgttgggcactaataacgttaat
ggcctgtcggaaattctgattggtcagggcgatattactaccgctgctaaaccgacctct
attgccaaatttgacctgatcccgcgcggtcaggtgccgccaaatccttctgaactgttg
atgagcgaacgctttgccgaactggtgaactgggcgagtaaaaactatgacctggtgttg
attgatacgccgccgattctggcagtgaccgatgcggcaattgttggtcgtcatgtcgga
accacgttaatggtggcgcgttatgcggtcaacacattgaaagaagtggaaaccagtctg
agccgctttgagcaaaacggtattccggtgaaaggggtgattctgaactccatcttccgc
cgcgccagcgcgtatcaggattatggctattacgaatacgaatataagtcggatgcgaaa
taa
              
                            

Download fasta file
RegulonDB