RegulonDB RegulonDB 10.9: Gene Sequence
wza gene sequence


Size: 1140        A: 286  T: 241  G: 294  C: 319

Fasta

 

>wza E. coli K12. Version NC_000913.3 GI:556503834
atgatgaaatccaaaatgaaattgatgccattattggtgtcagtaaccttgataagcggt
tgcacagtacttccgggcagcaatatgtcgacgatgggcaaagacgtcatcaaacagcag
gacgctgatttcgatctcgacaaaatggtgaatgtttatccgctgaccccgcgcctgatt
gaccaattacgcccacgcccgaatgtagcgcgccccaatatgacgctggaaagtgagatc
gcgaattaccagtatcgcgtcgggccgggggacgttcttaatgtcaccgtctgggatcac
ccggaactcaccacgccagccggtcagtaccgcagctccagcgacaccggcaactgggta
cagcctgacggcactatgttttacccgtatatcggcaaggtccacgtagtcgggaaaacg
ctcgctgaaatccgcagtgatattaccgggcgcttagcgacgtacatcgctgacccgcag
gtggacgttaatatcgccgccttccgctcacaaaaggcctatatctccggtcaggtgaat
aaatccggtcaacaggcgatcaccaacgtgccactgactattctcgacgccatcaacgcc
gcaggtggcctgaccgacaccgctgactggcgcaacgtggtgctaacacacaatggtcgt
gaagagcgcatttctttgcaggcgctgatgcaaaacggcgacctcaaccagaatcgcctg
ctttaccccggcgatattctctacgtgccacgtaatgatgatctgaaagtatttgtgatg
ggtgaagtgaagaaacagagcaccctgaaaatggactttagcggcatgaccctgactgaa
gccctgggcaatgctgaaggcatcgacatgaccacctccaacgccagcggcatctttgtc
attcgtccgctgaaaggcgagggcgggcgtaacggcaagattgccaatatctaccagctg
gatatgtccgatgccacgtcgctggtgatggcgacagaattccgcctgcaaccttatgac
gtggtgtatgtcaccaccgccccggtttcccgctggaaccgtctgatcaatcagttgctg
ccaactattagcggtgtccgttacatgacggatacagccagcgacattcataactggtaa
              
                            

Download fasta file
RegulonDB