RegulonDB RegulonDB 11.0: Gene Sequence
yegH gene sequence


Size: 1584        A: 350  T: 392  G: 451  C: 391

Fasta

 

>yegH E. coli K12. Version NC_000913.3 GI:556503834
atggaatggattgccgatccgtctatctgggccgggttaatcacgctgattgtgatcgaa
ctggtcctcggcattgataacctggtctttattgccatcctcgccgaaaaactaccgccg
aagcagcgtgaccgcgcacgggttaccgggctgctgctggcaatgttaatgcgcctgtta
ctgctggcgtcaatctcctggctggtcaccctgactcaaccgctgttcagcttccgctcg
tttacctttagcgcccgcgacttaatcatgctgtttggtggtttcttcctgttgttcaaa
gccacgatggagctgaacgaacggctggaagggaaagacagcaataatcccacacaacgc
aaaggtgcgaagttctggggcgtggtgacgcaaattgtggtactggacgccattttctca
ctcgactcagtgattaccgccgtcgggatggtcgaccatttactggtcatgatggccgcc
gtggttatcgctatcagcctgatgttgatggccagcaagccgttaacgcaatttgttaac
agtcacccgacgatcgttattctctgcttaagcttcctgttgatgattggctttagcctg
gtggcagaaggtttcggcttcgtcattccgaaaggctacctgtacgctgccattggtttc
tcggtgatgatcgaggcgctcaatcagttggctatctttaaccggcgacgttttctttcc
gctaaccagacgctgcgccagcggactaccgaagcggtaatgcgcctgcttagcgggcaa
aaagaagatgcggaactggacgccgaaaccgcgtccatgctggtggatcatggtaaccag
cagatctttaatccgcaggaacggcggatgattgagcgggtacttaatcttaaccagcgt
accgtcagcagcattatgacgtcgcgccacgatattgagcatatcgatctcaacgcgccg
gaagaagaaatccgccagttgctggagcgaaatcagcatacgcggctggtggttaccgac
ggtgatgacgcagaagatttgctcggtgttgttcacgttatcgacctgctacaacagtct
ctgcgcggcgaaccgctcaacctgcgggtgttgattcgccagccgctggtgttcccggaa
accttgccgttgttacctgccctggagcagttccgtaatgcccgcacgcactttgctttt
gtggtggatgagtttggctcggtggaagggattgtgacattaagtgacgtcactgaaacc
attgccggtaacttaccgaacgaagtggaagagatcgacgcccgccatgatattcagaag
aatgcggacggttcctggacggcgaatggtcatatgccgctggaggatctggtgcaatat
gtgccgctgccgctggatgaaaaacgtgaatatcacaccattgccgggctgttgatggag
tatttgcagcgtattccaaaacctggcgaagaagttcaggtgggggattatttgcttaaa
acgttgcaggtagaaagccatcgcgtgcagaaggtgcagattataccgctgcgtaaggat
ggcgagatggagtacgaggtgtga
              
                            

Download fasta file
RegulonDB