RegulonDB RegulonDB 10.9: Gene Sequence
yegI gene sequence


Size: 1947        A: 469  T: 488  G: 528  C: 462

Fasta

 

>yegI E. coli K12. Version NC_000913.3 GI:556503834
atgaaaacaaatataaaagtatttacatcgacaggtgaattgaccactcttggccgtgaa
ctgggcaaaggtggtgaaggcgcggtttatgatatcgaggagtttgtcgatagcgtcgcc
aagatttatcacacgccgccacccgccttaaaacaggacaaacttgcctttatggctgcg
acagctgacgcgcagttgttgaattatgtcgcctggccgcaggcaacgcttcacggtgga
cgaggcggaaaagttatcggttttatgatgccaaaagtttctggtaaagaaccgattcat
atgatctatagcccggcacatcgtcgccagagttaccctcattgtgcgtgggattttcta
ctctatgttgcgcgcaatattgcttcatcttttgctacggttcacgagcacgggcacgtc
gtgggtgacgtaaaccagaacagttttatggtaggtcgcgacagcaaagtggtactgatt
gatagcgactcctttcaaattaacgccaatggcacactgcatttatgcgaagtcggcgtg
tcgcattttacgccgccagagctacaaaccttgccatcatttgtcggttttgaacgcaca
gaaaatcacgataattttggccttgcgttgctaatttttcacgtcttgtttggtgggcgg
catccttattctggtgtgccgcttatctctgatgcgggtaatgcgctggagacggatatt
acccatttccgttatgcctacgcgtcagataatcagcgacgtggtttaaaaccgccgcca
cgatctattccgctatcgatgttaccgagtgatgttgaagccatgtttcagcaggcattc
acggaaagtggcgtggcaaccgggcgtccgacggctaaagcgtgggtagcggcactggac
tctctacgccaacagttaaagaaatgtatcgtttcagcaatgcatgtttaccccgctcat
ttgactgactgcccgtggtgtgcgctggataatcaaggtgttatctattttattgatctc
ggcgaagaggtcattaccaccggcgggaattttgtgctggcgaaagtctgggcgatggtg
atggcgtcagtagcaccgccagcattgcaactgccattacccgatcatttccaaccgact
ggcaggccgcttcctttaggcctgttacggcgcgaatacatcattctgcttgagatcgca
ctgtcagcattatcgctgctgctttgcggccttcaggcagaaccgcgttatattattttg
gttcctgtgctggcggctatctggattattggcagtctgacaagcaaagcgtacaaagca
gaagttcagcaacgccgtgaggcatttaatcgtgcgaaaatggactatgaccatttagtc
cgccagatccagcaggtaggcggcctggaaggttttatcgccaaacggacgatgctcgaa
aaaatgaaggacgaaattctcgggttaccggaagaagagaaacgcgctctggcagcactt
catgacactgcaagggaacggcagaagcagaagtttctggagggattttttattgatgtt
gcctctattcccggcgttggccctgcgcgtaaagcggcgttacggtcttttggtattgaa
acagccgcagatgttacccgtcgtggcgttaagcaagtgaaagggtttggcgaccatctg
acccaggcggttatcgactggaaagcgagctgtgaacgccgttttgtgttcaggccgaat
gaagcgataacgccagcagacagacaagcggtaatggcgaaaatgaccgccaaacgacat
cggctggaatcggcgttgacagtcggcgcgacagagttgcagcgattccgccttcatgct
ccagcacggaccatgccgttgatggaaccgttacgtcaggcagcagaaaaactggctcag
gcgcaggcagatttaagccgctgctga
              
                            

Download fasta file
RegulonDB