RegulonDB RegulonDB 10.9: Gene Sequence
yegJ gene sequence


Size: 462        A: 151  T: 121  G: 108  C: 82

Fasta

 

>yegJ E. coli K12. Version NC_000913.3 GI:556503834
atgaaaaagatattacttatgttgagtctgctattttttactaccgcgggctttagtgaa
gtttcggatacgttagtgacgggaggttatgataaacaagcgatgtctgacgcgattaaa
catgcgcggaaagaaaccgataaattcatcgaggttatgaataaaaaagatgccgatact
ttcgcagtcaaagccccgataaccgatcacggaagaaccgagcatttctggcttacggat
gtcacttattctaacggcatgtttattggcgtaatcagcaatgaccctggtattgttaca
aacgtagaatatggccaggagtggaaaatcaagaaagaagatatttcagactggatgtat
acgcgcggggataaaatttacggcggttataccattgatcctttattggtcacctatcca
aaagaagaagccgacgagctaagagcaaaattagttcgctaa
              
                            

Download fasta file
RegulonDB