RegulonDB RegulonDB 10.9: Gene Sequence
yegL gene sequence


Size: 660        A: 147  T: 176  G: 180  C: 157

Fasta

 

>yegL E. coli K12. Version NC_000913.3 GI:556503834
atgagcgaacaaatcacgtttgccaccagcgattttgccagtaacccggaaccacgttgc
ccctgcattttgctgctggatgtttctggttctatgaacggtagacctattaatgaactt
aacgccggattggttacctttcgtgatgaactgcttgctgatccgctggctttaaaaaga
gtggaactcggcattgtgacgttcggcccggtgcatgtggaacaaccctttaccagcgcc
gctaatttttttccgcccatcctgtttgcccagggcgatacaccaatgggtgcggccatt
accaaagccctggatatggtagaggagcggaaacgtgagtatcgtgcaaatggtatttcg
tattatcgcccgtggattttcctgattaccgatggtgcaccaaccgatgagtggcaggct
gcagccaacaaagtgtttcggggggaagaagataaaaggtttgctttcttttccatcggt
gttcagggggcggatatgaagacgctggcacaaattagcgttcgtcagcctttgcctctg
caaggattacaattccgtgaactgtttagctggttatccagttcgctgcgttcggtttcc
cgctccacgccgggaacggaagttgtgctggaagcgccaaaaggctggacgtcagtgtga
              
                            

Download fasta file
RegulonDB