RegulonDB RegulonDB 10.9: Gene Sequence
mdtB gene sequence


Size: 3123        A: 636  T: 719  G: 875  C: 893

Fasta

 

>mdtB E. coli K12. Version NC_000913.3 GI:556503834
atgcaggtgttacccccgagcagcacaggcggcccgtcgcgcctgtttattatgcgtcct
gtggccaccacgctgctgatggtggcgatcttactcgccgggattatcggttatcgcgcc
ctgcccgtttcggcgctgccggaagtggactatccgaccattcaggtggtcacgctctac
ccaggtgccagcccggatgtcatgacctctgccgttaccgcgccgctagaacgccagttc
gggcagatgtctggcctgaaacagatgtcgtcgcaaagttccggcggtgcgtcagttatc
actttgcagttccagctaacattaccgctcgatgtcgccgagcaggaagtgcaggccgcg
attaacgctgcgaccaacttgttgccgagcgatctgcctaacccgccggtttacagcaaa
gtgaacccggcagatccgccgatcatgacgctcgccgtcacctcaaccgccatgccgatg
acgcaagtggaagatatggtggaaacccgcgtcgcgcagaaaatctcgcagatttccggc
gtcggcctggtgacgctttccggcggtcagcgtccggctgttcgcgtcaaacttaacgct
caggcgattgccgccctcggcctgaccagcgaaaccgtgcgcaccgccattaccggcgct
aacgttaactcggcaaaaggtagcctcgacggcccttcccgtgcggtcacgctttccgcg
aacgaccagatgcaatccgccgaagagtatcgccagctaatcatcgcctaccagaacggc
gcgccaattcgtctgggcgatgtcgcaactgtagagcaaggtgcagaaaacagctggctc
ggcgcgtgggcgaacaaagaacaggccattgtgatgaatgttcagcgccagcccggtgct
aacattatctccaccgccgacagcattcggcagatgctgccacagctcactgagagtctg
ccgaaatcggtgaaggtgacagtgctttccgatcgcaccaccaatatccgcgcatccgtc
gatgatactcagtttgaattgatgatggctatcgcgctggtagtcatgattatctacctg
tttttgcgcaatattccggcgaccatcattcccggtgttgctgtaccgctgtcgttaatc
ggcactttcgcggttatggtgtttctcgatttttcaatcaataacctgacactgatggcg
ttaactatcgccaccggattcgtggtcgatgacgccatcgtggtgatcgaaaacatttcc
cgctatatcgaaaaaggcgaaaaaccgttggcggcggcgctcaagggcgcaggtgaaatc
ggctttaccattatctcgctgaccttctcactgattgcggtgttgatcccactgctgttt
atgggcgatatcgtcgggcgactgttccgcgaatttgctattaccctggcggtagcgatt
ttgatctcagcggtggtgtcgctgaccctgacaccgatgatgtgcgcgcggatgctcagc
caggagtcgttgcgtaaacagaaccgcttctcccgtgcctcggaaaaaatgttcgacagg
ataatcgccgcctatggtcgtggactggcgaaagtgctgaatcatccgtggctgacctta
agcgtggcactcagcacgctgctgcttagcgtgctgctgtgggtgttcattccgaaaggt
ttcttcccggtacaggacaatggcattattcagggcactttgcaggcaccgcaatccagc
tcctttgccaatatggcccagcgacaacgccaggtcgcggacgtgattttgcaggatccg
gcagtgcaaagcctgacctcatttgttggcgttgatggcactaacccgtcgctgaacagt
gcacgtttacaaatcaacctcaaaccgttggatgaacgtgatgatcgggtgcaaaaagtc
atcgcccgtctgcaaacggcggtagataaagtgccgggcgtcgatctcttcctgcaacca
acgcaggatctgactattgatactcaggtcagccgcacccagtaccagtttaccttgcag
gccacgtcactggatgcgctcagtacctgggtgccacagttgatggaaaaactccagcaa
ctgccacagctttctgatgtctccagcgactggcaggacaaagggctggtggcgtatgtc
aatgttgatcgcgacagcgccagccgtctggggatcagcatggcggatgtcgataacgcc
ctgtacaacgcgtttggtcagcggctgatttccactatttatactcaggccaaccagtat
cgcgtggtgctggagcacaacaccgaaaataccccaggcctcgcggcgctggataccatt
cgcctgaccagcagcgacggcggcgtggtgccgctaagctcaattgccaaaattgagcag
cgttttgcgccgctctccatcaaccatctggatcagttcccggtaacgaccatctccttt
aacgtgccggataactattcgctgggcgatgcggtgcaggcgattatggacaccgaaaag
acgctgaatctgccggtggatatcaccacgcagttccagggcagcaccctcgccttccag
tcggcgctgggcagcactgtctggctgattgtcgcggcggtggtggcgatgtatatcgtg
ctcggcattctgtacgagagctttattcacccgatcaccattctctcgacgctacccacc
gcaggggttggcgcactgctggcgttgctgattgctggtagcgaactggatgtgattgcg
attatcggcattattttgctgatcggtatcgtgaagaagaacgccatcatgatgatcgac
ttcgcgctggctgctgagcgcgagcaaggcatgtcgccgcgcgaggcaatctaccaggct
tgtctgttgcgttttcgtccgatcctgatgaccactctggcggctctgcttggcgcgctg
ccgctgatgttgagtaccggggtcggcgcggaactgcgtcgtccgttaggtatcggcatg
gtcggcggtctgattgtcagccaggtgctgacgctgtttaccacgccggtgatttatttg
ctgttcgaccgcctggcattgtggaccaaaagccgctttgcccgtcatgaagaggaggcg
taa
              
                            

Download fasta file
RegulonDB