RegulonDB RegulonDB 10.9: Gene Sequence
mdtC gene sequence


Size: 3078        A: 633  T: 713  G: 897  C: 835

Fasta

 

>mdtC E. coli K12. Version NC_000913.3 GI:556503834
gtgaagttttttgccctcttcatttaccgcccggtggcgacgattttactgtcggttgcc
attaccctgtgcggcatactgggcttccgtatgctgccggtcgccccgctgccgcaggtc
gattttccggtgattatcgtcagcgcctcgctgcccggtgcgtcaccagaaacaatggcg
tcttccgttgccacgccgctggagcgctcacttgggcgcattgccggagtcagtgaaatg
acctccagcagttcgctcggcagcacgcgtattattttgcagtttgattttgaccgggat
atcaacggcgcagcgcgtgatgtgcaggcggcgatcaacgctgcacaaagtttgctgccc
agtgggatgcccagccgcccgacctatcgcaaagcgaacccgtcggatgcgccaattatg
atcctcacgctgacgtccgatacttattcgcagggtgaactgtacgatttcgcctcgacg
cagctggctccgacgatttcgcaaatcgacggtgttggtgatgtcgatgtcggaggcagc
tcactgcccgccgtacgcgtcgggctgaatccgcaggcgctgtttaatcagggcgtgtcg
ctggacgacgtacgcaccgccgtcagcaatgccaacgtgcgtaaaccgcagggcgcgctg
gaagatggcactcaccgctggcagatccagaccaatgatgagctaaaaaccgccgctgaa
tatcagccgttgattattcactacaacaacggcggcgcggttcgtctgggcgatgtggcg
acggtgaccgactcagtgcaggatgtgcgcaacgccgggatgaccaacgccaaaccggct
attttactgatgatccgcaaactgccggaagccaatattatccagacggttgacagcatc
cgggcaaaattaccggagttgcaggaaaccattccggcggcgattgatctgcaaattgcc
caggatcgctcccccaccattcgcgcctcgctggaagaagtcgagcaaacgctgattatc
tcggtggcgctggtgattctggtggtgtttttattcctgcgctcgggtcgcgccactatt
attcccgccgtttcggtgccggtttcgctgattggtacgtttgcggcgatgtacctgtgc
ggattcagtctcaataacctttcgttaatggcgctcaccatcgctactggtttcgtggtg
gatgacgccatcgtggtgctggaaaacattgcacgtcatctggaagcgggaatgaaaccg
ttgcaagccgcactgcaaggtactcgcgaagtcggttttacggtgctgtcgatgagtctg
tcactggtggcggtgttcctgccgctgctgttgatgggcggattgccgggccgactgtta
cgcgaatttgccgtgacgctttctgtcgccattggtatatcgttgctggtttctctgaca
ttaacgccaatgatgtgtggctggatgctgaaagccagcaagccgcgcgagcaaaagcga
ctgcgtggttttggtcgcatgttggtagccctgcaacaaggctacggcaagtcactaaaa
tgggtgctcaatcatacccgtctggtgggcgtggtgctgcttggcaccattgcgctgaat
atctggctgtatatctcgatcccgaaaaccttcttcccggagcaggacactggcgtgttg
atgggcgggattcaggcggatcagagtatttcgtttcaggcgatgcgcggtaagttgcag
gatttcatgaaaattatccgtgacgatccggcagtggataatgtcaccggctttacaggc
ggttcgcgagtgaacagcgggatgatgtttatcaccctcaagccacgcgacgaacgcagc
gaaacggcgcagcaaattatcgaccgtctgcgcgtaaaactggcgaaagaaccgggggcg
aatctgttcctgatggcggtacaggatattcgcgttggtgggcgtcagtcgaacgccagc
taccagtacacgttgttatccgacgacctggcggcactgcgagaatgggagccgaaaatc
cgcaaaaaactggcgacgttgccggaactggcggacgtgaactccgatcagcaggataac
ggcgcggagatgaatctggtttacgaccgcgacaccatggcacggctgggaatcgacgta
caagccgccaacagtctgttaaataacgccttcggtcagcggcaaatctcgaccatttac
cagccgatgaaccagtataaagtggtgatggaagtggatccgcgctatacccaggacatc
agtgcgctggaaaaaatgttcgttatcaataacgaaggcaaagcgatcccgctgtcgtat
ttcgctaaatggcaaccggcgaatgccccactatcggtgaatcatcagggattatcggcg
gcctcgaccatttcgtttaacctgccgaccggaaaatcgctctcggacgccagtgcggcg
atcgatcgcgcaatgacccagcttggtgtgccttcgacggtgcgcggcagttttgccggc
acggcgcaggtgttccaggagacgatgaactcgcaggtgatcctgattatcgccgccatc
gccacggtgtatatcgtgctgggtatcctttacgagagttacgtacatccgctgacgatt
ctctccaccctgccctcggcgggcgttggagcgctgttggcgctggagctgttcaatgcc
ccgttcagcctaatcgccctgatagggatcatgctattaatcggcatcgtgaagaaaaac
gccattatgatggtcgattttgcgcttgaagcccaacggcacggtaacctgacgccgcag
gaagctattttccaggcctgtctgctgcgttttcgcccgattatgatgactaccctggcg
gcgctgtttggtgcgctgccgctggtattgtcgggcggcgacggctcggagctgcggcaa
cccctggggatcaccattgtcggcggactggtaatgagccagctccttacgctgtatacc
acgccggtggtgtatctctttttcgaccgtctgcggctgcgtttttcgcgtaaacctaaa
caaacggtaaccgagtaa
              
                            

Download fasta file
RegulonDB