RegulonDB RegulonDB 10.9: Gene Sequence
yegP gene sequence


Size: 333        A: 106  T: 67  G: 80  C: 80

Fasta

 

>yegP E. coli K12. Version NC_000913.3 GI:556503834
atggctggttggtttgaactcagtaagagcagtgataatcagttccggtttgtgctaaaa
gcgggcaatggtgagactatcctcaccagcgagctttatacctcaaaaacctctgcggaa
aagggcatcgcgtcggtgcgtagcaacagcccgcaagaagaacgctatgagaaaaaaacg
gcaagtaacggcaaattctatttcaatctgaaagccgctaatcatcaaattatcggctcc
agccagatgtacgccaccgcgcaatctcgtgaaaccggaattgcctccgttaaagccaat
ggcacaagccagacggtgaaagacaatacgtaa
              
                            

Download fasta file
RegulonDB