RegulonDB RegulonDB 10.9: Gene Sequence
trhP gene sequence


Size: 1362        A: 331  T: 294  G: 375  C: 362

Fasta

 

>trhP E. coli K12. Version NC_000913.3 GI:556503834
atgtttaaaccggaactcctttccccggcgggaacgctgaaaaatatgcgttacgctttc
gcttatggcgcagatgctgtttatgcgggccagccgcgttattccctgcgtgtgcgcaac
aacgaattcaaccacgaaaatcttcagctcggcatcaatgaagcccacgcgctggggaaa
aagttttatgtcgtggtcaacattgcaccgcacaacgccaagctgaaaacctttatccgt
gacctgaaaccggtggtggaaatggggccggatgcgctgattatgtccgatccagggctg
attatgctggtgcgtgagcacttccctgaaatgccgatccacctttcggtgcaggctaac
gccgtgaactgggcgacggtgaaattctggcagcaaatgggcctgacccgcgtgatcctc
tctcgcgagctgtcgctggaagagattgaagagatccgcaatcaggtgccggatatggag
atcgagatcttcgttcacggcgcgctgtgcatggcctactccggtcgctgcctgctctct
ggctatatcaacaagcgcgacccgaaccagggcacctgcaccaacgcctgccgctgggag
tacaacgtccaggaagggaaagaagatgatgttggcaacatcgtacacaagtacgagccg
attccggtgcaaaatgttgagccgacgctgggtatcggcgcaccaaccgacaaagtgttt
atgatcgaagaggcccagcgtccgggcgagtatatgaccgcgtttgaagatgagcacggc
acttacatcatgaactcgaaagatctgcgcgccatcgcccatgtagaacgcctgaccaaa
atgggcgtgcattcgctgaaaatcgaaggtcgtaccaaatctttctactattgtgcacgc
accgcacaggtttaccgcaaagctatcgatgacgccgctgcgggaaaaccgttcgatacc
agcctgctggaaactctggaaggtctggcgcatcgtggctataccgaaggtttcctgcgt
cgtcatactcacgacgattatcagaactacgaatacggttattcagtttctgaccgccag
cagtttgttggtgagtttaccggtgagcgcaagggggacctcgcggcggtagcggtgaaa
aataaattctccgttggcgacagccttgagctgatgacgccgcaaggcaacattaatttt
acccttgagcacatggaaaacgccaaaggcgaagctatgccgatagcaccaggcgatggt
tatactgtgtggctcccggtcccgcaggatcttgagctcaattacgcgctgctgatgcgt
aatttctccggggaaaccacgcgtaatccccacggtaagtga
              
                            

Download fasta file
RegulonDB