RegulonDB RegulonDB 10.9: Gene Sequence
yegZ gene sequence


Size: 219        A: 60  T: 51  G: 61  C: 47

Fasta

 

>yegZ E. coli K12. Version NC_000913.3 GI:556503834
gcccgtgtagcagagttctccatcagcctggctaccggtcgggcagatatttacacggaa
acaccggtcaaagtgtctggctttaagcgcgtcatagacgagcaggactggacaatcact
aaggtgacacattttctgaataatagcggcttcacgacgtcattagagcttgaggtcagg
ctttctgatgtggggtacgaaacagaagataatgagtga
              
                            

Download fasta file
RegulonDB