RegulonDB RegulonDB 10.9: Gene Sequence
null gene sequence


Size: 267        A: 74  T: 65  G: 79  C: 49

Fasta

 

>null E. coli K12. Version NC_000913.3 GI:556503834
atgtggagagtgagaatattttttggtaagcgtcaaatatgcgcgttctggctgtgcgta
gccggaacctgtgggagcacgatgccgataagtgaaaggcatcgtgctatgaaggaggat
tctatcgatgtggtcaatggaagacggttaccagagatagggcttatgcataaaaaaata
agcccgtgtagcagagttctccatcagcctggctaccggtcgggcagatatttacacgga
aacaccggtcaaagtgtctggctttaa
              
                            

Download fasta file
RegulonDB