RegulonDB RegulonDB 10.9: Gene Sequence
yegR gene sequence


Size: 318        A: 109  T: 93  G: 71  C: 45

Fasta

 

>yegR E. coli K12. Version NC_000913.3 GI:556503834
atgaaaaagatagctgctatatcattaattagtatttttattatgtctggttgtgctgtg
cataatgatgagacaagtatcggtaaatttggtcttgcatataaaagtaatattcagcgt
aaactcgataaccaatactacaccgaagccgaagcttctttagccaggggtagaatatct
ggtgcagaaaatatagtaaaaaatgatgcaactcatttctgtgttactcagggcaaaaaa
atgcaaatagttgagctgaagacagaaggtgtaggattacatggtgtcgctcgtctgaca
ttcaaatgtggagagtga
              
                            

Download fasta file
RegulonDB