RegulonDB RegulonDB 10.9: Gene Sequence
yegS gene sequence


Size: 900        A: 226  T: 227  G: 246  C: 201

Fasta

 

>yegS E. coli K12. Version NC_000913.3 GI:556503834
atggcagaatttcccgccagcttactgattcttaatggcaaaagtactgacaatctaccc
ttgcgcgaagcaattatgctgttgcgtgaggaaggaatgacgatccatgtgcgggtcacc
tgggagaaaggcgatgccgcacgatatgtagaggaggcccggaagtttggcgtcgcaacg
gtgattgccggtggtggcgatggcaccattaatgaagtttctacggcgttgattcagtgt
gagggggatgacatacccgcgctgggaattttgccattaggaaccgccaatgattttgcc
accagtgtagggattcctgaggcactggataaggcgctgaaactggcaattgccggtgac
gccattgcgatagatatggcgcaggtcaacaaacaaacctgttttattaatatggcgaca
ggcggatttgggacgcgtattaccacagaaacgccggaaaaattaaaagccgcgctgggt
agcgtctcttacatcattcatggcttaatgcgtatggatactctgcaaccggaccgttgt
gaaatccgcggtgaaaactttcactggcaaggtgacgccctggtcattggtattggtaac
gggcgtcaggccggtggcggtcagcaattgtgtccgaacgcgttaattaacgatggcttg
ctgcaactgcgcatttttaccggcgatgaaatacttccggctctcgtatcaaccttaaaa
tctgacgaagataacccgaatattatcgaaggcgcttcgtcgtggtttgatattcaggca
ccacacgacatcacctttaatcttgatggcgaaccgttgagtgggcaaaattttcatatt
gaaatacttccggcagcgttgcgttgtcgattaccaccagattgtccactgttgcgttaa
              
                            

Download fasta file
RegulonDB