RegulonDB RegulonDB 10.9: Gene Sequence
gatZ gene sequence


Size: 1263        A: 327  T: 318  G: 331  C: 287

Fasta

 

>gatZ E. coli K12. Version NC_000913.3 GI:556503834
atgaaaacgttaattgcccggcataaagctggtgaacatatcggcatatgttcagtctgt
tctgcccatccgttggttatcgaagcggcgctggcatttgatcgcaacagcacgcgcaaa
gtgctgattgaagcaacgtcaaaccaggtcaatcaatttggcggttataccggaatgaca
ccggcagactttcgcgaatttgtttttacgattgccgataaagttgggtttgcacgcgaa
cgcattattctcggcggcgatcatctggggccaaactgctggcagcaagaaaatgcggat
gcggcgatggaaaaatccgtcgagctggtaaaggaatatgttcgtgccggcttcagtaaa
attcatcttgatgcgtcaatgtcctgcgcgggggatcccataccgttagcaccagaaacg
gttgcggaacgagctgctgtgctttgctttgctgcggaaagtgtggcgacagattgccag
cgtgagcaactgagctatgtcattggcaccgaagttccggttccgggcggtgaggccagc
gccattcagtcagtacacatcacccatgttgaagatgccgccaatactttacgtacgcat
caaaaggcctttattgcccgtgggctgacagaggcgttaacacgtgtgattgccatcgtg
gtgcagccgggtgtggaatttgatcacagcaatattatccattatcagccgcaggaagcg
cagccgctggcgcaatggatagaaaacacccgaatggtttatgaagcacattctaccgat
taccagacccggacggcttattgggaattagtccgcgatcactttgcaatattgaaagtc
ggtcccgcattaacctttgctttacgcgaggcgatatttgcactggcacaaattgagcag
gaacttatcgcccctgaaaatcgcagcggttgcctggcggtaattgaagaagtgatgctc
gacgaaccgcaatactggaaaaaatattatcgtacgggttttaacgattcattactggat
attcgttacagcctgtcggatcgtattcgttattactggccgcatagtcggattaaaaat
agcgtcgaaacgatgatggtgaatcttgaaggcgtggacatcccactgggcatgattagt
cagtatcttcccaaacaatttgaacgcattcagtccggggaattatcagcaataccgcat
cagctgattatggataaaatttatgatgttttgcgcgcctatcgctacggctgtgcggaa
taa
              
                            

Download fasta file
RegulonDB