RegulonDB RegulonDB 10.9: Gene Sequence
fbaB gene sequence


Size: 1053        A: 257  T: 257  G: 283  C: 256

Fasta

 

>fbaB E. coli K12. Version NC_000913.3 GI:556503834
atgacagatattgcgcagttgcttggcaaagacgccgacaaccttttacagcaccgttgt
atgacaattccttctgaccagctttatctccccggacatgactacgtagaccgcgtaatg
attgacaataatcgcccgccagcggtgttacgtaatatgcagacgttgtacaacaccggg
cgtctggctggcacaggatatctttctattctgccggttgaccagggcgttgagcactct
gccggagcttcatttgctgctaacccgctctactttgacccgaaaaacattgttgaactg
gcgatcgaagcgggctgtaactgtgtggcgtcaacttacggcgtgctggcgtcggtatcg
cggcgttatgcgcatcgcattccattcctcgtcaaacttaatcacaacgagacgctaagt
tacccgaatacctacgatcaaacgctgtatgccagcgtggagcaggcgttcaacatgggc
gcggttgcggttggtgcgactatctattttggctcggaagagtcacgtcgccagattgaa
gaaatttctgcggcttttgaacgtgcgcacgagctgggtatggtgacagtgctgtgggcc
tatttgcgtaactccgcctttaagaaagatggcgttgattaccatgtttccgccgacctg
accggtcaggcaaaccatctggcggcaaccatcggtgcagatatcgtcaaacaaaaaatg
gcggaaaataacggcggctataaagcaattaattacggttacaccgacgatcgtgtttac
agcaaattgaccagcgaaaacccgattgatctggtgcgttatcagttagctaactgctat
atgggtcgggctgggttgataaactccggcggtgctgcgggcggtgaaactgacctcagc
gatgcagtgcgtactgcggttatcaacaaacgcgcaggcggaatggggctgattcttgga
cgtaaagcgttcaagaaatcgatggctgacggcgtgaaactgattaacgccgtgcaggac
gtttatctcgatagcaaaattactatcgcctga
              
                            

Download fasta file
RegulonDB