RegulonDB RegulonDB 10.9: Gene Sequence
yegT gene sequence


Size: 1278        A: 252  T: 384  G: 328  C: 314

Fasta

 

>yegT E. coli K12. Version NC_000913.3 GI:556503834
atgaaaacaacagcaaagctgtcgttcatgatgtttgttgaatggtttatctggggcgcg
tggtttgtgccattgtggttgtggttaagtaaaagcggttttagtgccggagaaattggc
tggtcgtatgcctgtaccgccattgcggcgatcctgtcgccaattctggttggctccatc
actgaccgctttttctcggcgcaaaaagtgctggcggtattgatgttcgcaggcgcgctg
ctgatgtatttcgctgcgcaacagaccacttttgccgggttcttcccgttactgctggcc
tactcgctaacctatatgccgaccattgcgctgactaacagcatcgcttttgccaacgtg
ccggatgttgagcgtgatttcccgcgcattcgtgtgatgggcactatcggctggattgcc
tccggtctggcatgtggtttcttgccgcaaatactggggtatgccgatatctcaccgact
aacatcccgctgctgattaccgccggaagttctgctctgctcggtgtgtttgcgtttttc
ctgcccgacacgccaccaaaaagcaccggcaaaatggatattaaagtcatgctcggcctg
gatgcgctgatcctgctgcgcgataaaaacttcctcgtctttttcttctgttcattcctg
tttgcgatgccactagcgttctattacatctttgccaacggttatctgaccgaagttggc
atgaaaaacgccaccggctggatgacgctcggccagttctctgaaatcttctttatgctg
gcattgccgtttttcactaaacgctttggtatcaaaaaggtattattgcttggtctggtc
accgctgcgatccgctatggcttctttatttacggtagtgcggatgaatatttcacctac
gcgttactgttcctcggtattttgcttcacggcgtaagttacgatttttactacgttacc
gcttacatctatgtcgataaaaaagcccccgtgcatatgcgtaccgctgcgcaggggctg
atcacgctctgctgccagggcttcggcagtttgctcggctatcgtcttggcggtgtgatg
atggaaaagatgttcgcttatcaggaaccggtaaacggactgactttcaactggtccggg
atgtggactttcggcgcggtgatgattgccattatcgccgtgctgttcatgatttttttc
cgcgaatccgacaacgaaattacggctatcaaggtcgatgatcgcgatattgcgttgaca
caaggggaagttaaatga
              
                            

Download fasta file
RegulonDB