RegulonDB RegulonDB 10.9: Gene Sequence
yegU gene sequence


Size: 1005        A: 217  T: 229  G: 290  C: 269

Fasta

 

>yegU E. coli K12. Version NC_000913.3 GI:556503834
atgaaaacagaacgtattctcggtgctctttatgggcaggcgttaggggatgcgatgggg
atgccctccgagctttggccacgcagccgcgttaaagcacactttggctggattgaccgt
tttcttcctggaccaaaggagaataacgcggcctgttattttaaccgcgccgaattcacc
gacgatacctcgatggcgctgtgtctggcggatgcgttactggaacgtgaaggcaagatc
gatccggatctgattgggcgtaatattctcgactgggcgctgcgtttcgacgcctttaac
aaaaacgtactaggtccgacctcgaagattgcgcttaacgccattcgcgacggtaaaccc
gttgctgaactggaaaacaacggcgtgaccaacggcgcagcgatgcgcgtctcgccatta
ggttgtttgcttccggcgcgtgatgttgattcctttattgatgatgtagcgctggcgtcc
agcccgacccataaatccgatctggcggttgcaggcgcggtagtcatcgcatgggcgatt
tctcgtgccattgacggagaaagctggtcagcgattgttgattccctgccttcaattgcg
cgacatgcacagcaaaaacgcatcactacgttcagcgcctcactggcggcgcggctggag
attgcgctgaaaattgtgcgcaatgccgacggcaccgaatccgccagcgaacagctttac
caggtcgttggcgcaggtaccagcactattgagtccgttccgtgcgccattgcgctggtt
gaactggcacaaaccgacccgaatcgctgcgccgtcctgtgcgctaaccttggcggcgac
acagacaccatcggtgctatggcgacggcaatttgcggcgcgttgcatggcgttaacgct
atcgatcctgcgttaaaggcggaactggatgcggtaaatcagcttgatttcaaccgctat
gccacagcgctggcgaaatatcgtcaacaacgggaggcggtatga
              
                            

Download fasta file
RegulonDB